polypeptide, dimer, composition, nucleic acid molecule, recombinant expression vector, microbial hos

专利摘要:
POLYPEPTIDE, COMPOSITION, NUCLEIC ACID MOLECULE, RECOMBINANT EXPRESSION VECTOR, TRANSFORMED HOST CELL, METHOD TO PREPARE THE POLYPEPTIDE, COMPOSITION CONTAINING NUCLEASSE FOR USE IN A NORMAL TREATMENT AND METHOD OF TREATMENT AND TREATMENT METHODS immune-related disorder in a mammal, and a pharmaceutical composition for treating an immune-related disease in a mammal.
公开号:BR112013027547B1
申请号:R112013027547-2
申请日:2012-04-27
公开日:2021-01-19
发明作者:Jeffrey A. Ledbetter；Martha Hayden-Ledbetter；Keith Elkon；Xizhang Sun
申请人:University Of Washington；
IPC主号:

专利说明:

Background of the invention
[0001] Excessive release of (ribo) nucleoprotein particles from dead cells or dying cells can cause lupus pathology through two mechanisms: (i) deposition or in situ formation of chromatin / anti-chromatin complexes that cause nephritis and lead to loss of renal function; and (ii) the nucleoproteins activate innate immunity through the Toll-like receptor (TLR) 7, 8, and 9, as well as the TLR-independent routes. The release of the nucleoproteins can serve as a potent antigen for autoantibodies in the SLE, providing amplification of the B cell and the activation of DC through the co-meshing of the antigen receptors and TLRs. Thus, there is a need for a means of removing the inciting antigens and / or attenuating the immune stimulus, immune amplification, and the disease mediated by the immune complex in individuals needing it. Summary of the invention
[0002] A hybrid nuclease molecule comprising a first nuclease domain and a modified Fc domain is described herein, where the first nuclease domain is operably linked to the Fc domain. The Fc domain is modified so that the molecule has reduced toxicity compared to a hybrid nuclease molecule having an unmodified Fc domain. In some embodiments, the hybrid nuclease molecule has an Fc domain that has been modified to decrease binding to FcY receptors, complement proteins, or both. In some embodiments, the hybrid nuclease molecule has reduced cytotoxicity at least 1, 2, 3, 4, or 5 times compared to a control molecule, for example, to a hybrid nuclease molecule without a modified Fc domain.
[0003] In some embodiments, the hybrid nuclease molecule additionally includes a first linker domain, and the first nuclease domain is operably coupled to modify the Fc domain by the first linker domain.
[0004] In some respects, the hybrid nuclease molecule includes a modified Fc domain that is a mutant, IgG1 Fc domain. In some respects, a mutant Fc domain comprises one or more mutations in the joint, in the CH2 and / or CH3 domains. In some respects, the Fc domain comprises an amino acid sequence having one or more of the P238S, P331S, SCC, SSS mutations (residues 220, 226, and 229), G236R, L328R, L234A, and L235A. In some respects, the mutant Fc domain includes a P238s mutation. In some respects, the mutant Fc domain includes a P331s mutation. In some respects, a mutant Fc domain comprises P238S and / or P331S, and can include mutations in one or more of the three cysteine joints. In some respects, a mutant Fc domain comprises P238S and / or P331S, and / or one or more mutations in the three cysteine joints. In some respects, a mutant Fc domain comprises P238S and / or P331S, and / or mutations in one of the three cysteine joints (located at residue 220 by the EU number) for SCC (where CCC refers to the three cysteines present in the allele-wild articulation). In some respects, a mutant Fc domain comprises P238S, and / or P331S, and / or mutations in the three cysteine joints (located in residues 220, 226 and 229 by the EU number) for SSS. In some respects, a mutant Fc domain comprises P238S and P331S and mutations in the three cysteine joints. In some respects, a mutant Fc domain comprises P238S and P331 and SCC.
[0005] In some respects, a mutant Fc domain comprises P238S and P331S and SSS. In some respects, an Fc mutant domain includes P238S and SCC. In some respects, a mutant Fc domain includes P238S and SSS. In some respects, a mutant Fc domain includes P331S and SCC. In some respects, a mutant Fc domain includes P331S and SS. In some respects, a mutant Fc domain includes mutations in one or more of the three cysteine joints. In some respects, a mutant Fc domain includes a mutation in the three cysteine joints. In some respects, a mutant Fc domain includes a mutation in the three cysteine joints for SCC. In some respects, a mutant Fc domain includes a mutation in the three joints of cysteines and SSS. In some respects, a mutant Fc domain includes SCC. In some respects, a mutant Fc domain includes SSS.
[0006] In some respects, a nucleic acid encoding a mutant Fc domain is as shown in SEQ ID NO: 59. In some respects, a mutant Fc domain is as shown in SEQ ID NO: 60. In some respects, a nucleic acid encoding a mutant Fc domain is as shown in SEQ ID NO: 71. In some respects, a nucleic acid encoding a mutant Fc domain is as shown in SEQ ID NO: 72. In some respects, a nucleic acid encoding a mutant Fc domain is as shown in SEQ ID NO: 73. In some respects, a nucleic acid encoding a mutant Fc domain is as shown in SEQ ID NO: 74. In some respects, a nucleic acid encoding a mutant Fc domain is as shown in SEQ ID NO: 75. In some respects, a nucleic acid encoding a mutant Fc domain is as shown in SEQ ID NO: 76. In some respects, a nucleic acid encoding a mutant Fc domain is as shown in SEQ ID NO: 87. In some respects, a nucleic acid encoding a mutant Fc domain is as shown in SEQ ID NO: 88. In some respects, a nucleic acid encoding a mutant Fc domain is as shown in SEQ ID NO: 89. In some respects, a nucleic acid encoding a mutant Fc domain is as shown in SEQ ID NO: 90.
[0007] In some respects, a hybrid nuclease molecule comprises a wild allele, a human RNase 1 domain linked to a mutant, a human IgG1 Fc domain comprising SCC, P238S, and P331S, or a mutant, the human IgG1 Fc domain comprising SSS, P238S, and P331S. In some respects, a nucleic acid encoding a hybrid nuclease molecule is as shown in SEQ ID NOs: 61, 77, or 91. In some aspects, a hybrid nuclease molecule is as shown in SEQ ID NOs: 209, 62, 79, 92 or 94.
[0008] In some respects, a hybrid nuclease molecule comprises a wild allele, a human RNase 1 domain linked via a linker (Gli4Ser) 4 domain to a mutant human IgG1 Fc domain comprising SCC, P238S, and P331S, or a domain Mutant human IgG1 Fc comprising SSS, P238S, and P331S. In some respects, a nucleic acid encoding a hybrid nuclease molecule is as shown in SEQ ID NOs: 63, or 79. In some aspects, a hybrid nuclease molecule is as shown in SEQ ID NOs: 64 or 79.
[0009] In some respects, a hybrid nuclease molecule comprises a human A114F DNase 1 domain G105R linked via a linker domain (Gli4Ser) 4 to a mutant human IgG1 Fc domain comprising SCC, P238S, and P331S, linked via an NLG linker domain to a wild-type human RNAse domain. In some aspects, a hybrid nuclease molecule comprises a DNase 1 domain G105R A114F linked via a binding domain to a mutant human IgG1 Fc domain comprising SSS, P238, and P31, linked via an NLG binding domain to a wild human RNase 1 domain . In some respects, a nucleic acid encoding a hybrid nuclease molecule is as shown in SEQ ID NOs: 65 or 81. In some aspects, a hybrid nuclease molecule is as shown in SEQ ID NO: 66, or 82.
[0010] In other embodiments, a hybrid nuclease molecule comprises an amino acid sequence represented in SEQ ID NOs: 62, 64, 78, 80, 92, or 96, or a hybrid nuclease molecule comprising an amino acid sequence of at least 90 % identical to the amino acid sequence represented in SEQ ID NOs: 62, 64, 78, 80, 92, or 96. In some respects, a hybrid nuclease molecule comprises an amino acid sequence represented in SEQ ID NO: 96. In other respects, a hybrid nuclease molecule comprises an amino acid sequence represented in SEQ ID NOs: 66, 68, 70, 82, 84, 86, 94, or 98, or a hybrid nuclease molecule comprising an amino acid sequence at least 90% identical to the amino acid sequence represented in SEQ ID NOs: 66, 68, 70, 82, 84, 86, 94, or 98. In another aspect, a hybrid nuclease molecule comprises an amino acid sequence represented in SEQ ID NO: 98.
[0011] In some respects, a hybrid nuclease molecule comprises a wild-type human RNase 1 domain linked via a linker domain (Gli4Ser) 4 to a mutant human IgG1 Fc domain comprising SCC, P238S, and P331S, linked via an NLG linker domain to a human DNase 1 G105R A114F domain. In some aspects, a hybrid nuclease molecule comprises a wild-type human RNase 1 domain, linked via a linker domain (Gli4Ser) 4 to a mutant human IgG1 Fc domain comprising SSS, P238S, and P331S, linked via an NLG linker domain to a human DNase 1 domain G105R A114F. In some respects, a nucleic acid encoding a hybrid nuclease molecule is as shown in SEQ ID NOs: 67, or 83. In some aspects, a hybrid nuclease molecule is as shown in SEQ ID NOs: 68 or 84.
In some respects, a hybrid nuclease molecule comprises a human allele-wild RNase 1 domain linked to a mutant human IgG1 Fc domain comprising SCC, P238S, and P331S linked via an NLG linker domain to a human G105R A114F domain . In some aspects, a hybrid nuclease molecule comprises a wild-type human RNase 1 domain linked to a mutant human IgG1 Fc domain comprising SSS, P238S, and P331S linked via an NLG linker domain to a human G105R A114F DNase domain. In some respects, a nucleic acid encoding a hybrid nuclease molecule is shown in SEQ ID NOs: 69, 85, or 93. In some aspects, a hybrid nuclease molecule is shown in SEQ ID NOs: 70, 86, 94, or 98.
[0013] In some respects, the cytotoxicity induced by a hybrid nuclease molecule is reduced when compared to a control molecule. In some respects, the cytotoxicity induced by a hybrid nuclease molecule is reduced by about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 , 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66 , 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 100% when compared to a control molecule. In some aspects, the hybrid nuclease molecule has about 3-5 times or at least 3 times reduced cytotoxicity when compared to a hybrid nuclease molecule having an unmodified Fc domain (e.g., an allele-wild Fc domain).
[0014] In some respects, the activity of a hybrid nuclease molecule having a DNase is no less than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or> 30 times less than the activity of a control DNase molecule. In some respects, the activity of a hybrid nuclease molecule having a DNase is about equal to the activity of a control DNase molecule. In some respects, the activity of a hybrid nuclease molecule having an RNase of not less than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or> 30 times less than the activity of a control RNase molecule. In some respects, the activity of a hybrid nuclease molecule having an RNase is about equal to the activity of a control RNase molecule.
[0015] In some embodiments, a hybrid nuclease molecule is a polypeptide, where the amino acid sequence of the first nuclease domain comprises a human allele-wild-type RNase amino acid sequence, where the first linker domain is (GliSer) n, where n is 0, 1, 2, 3, 4, or 5, where the amino acid sequence of the Fc domain comprises an amino acid sequence of the human mutant IgG1 Fc domain, and the first linker domain is coupled to the C-terminus of the first nuclease domain and the N-terminal of the Fc domain. In some embodiments, a hybrid nuclease molecule is a polypeptide comprising or consisting of a sequence shown in Table 1.
[0016] In some embodiments, a hybrid nuclease molecule comprises a human allele-wild DNase 1 linked to a mutant, a human IgG1 Fc domain. In some embodiments, a hybrid nuclease molecule comprises a human DNase 1 G105 R A114F linked to a mutant, a human IgG1 Fc domain by a linker domain (Gli4Ser) n where n = 0, 1, 2, 3, 4 or 5. In some embodiments, a hybrid nuclease molecule comprises human allele-wild RNase linked to a mutant, a human mutant IgG1 Fc domain linked to a human allele-wild DNase 1. In some embodiments, the hybrid nuclease molecule comprises a wild-type human allele RNase linked to a mutant human IgG1 Fc domain linked to a human G105R A114F DNase 1. In some embodiments, a hybrid nuclease molecule is a polypeptide, where the amino acid sequence of the first nuclease domain comprises an RNase amino acid sequence, where the first linker domain is between 5 and 32 amino acids in length, where the amino acid sequence of The Fc domain comprises an amino acid sequence of the human Fc domain, and where the first linker domain is coupled to the C-terminus of the first nuclease domain and the N-terminus of the Fc domain. In some embodiments, the linker domain includes (Gli4Ser) 5 and Bg1II, AgeI, and XhoI restriction sites. In some embodiments, a hybrid nuclease molecule is a polypeptide, where the amino acid sequence of the first nuclease domain comprises a human RNase amino acid sequence, where the first linker domain is an NLG peptide between 5 and 32 amino acids in length, where the amino acid sequence of the Fc domain comprises an amino acid sequence of the human mutant Fc domain, and where the first linker domain is coupled to the C-terminus of the first nuclease domain and the N-terminus of the Fc domain.
[0017] In some embodiments, the Fc domain does not substantially bind to an Fc receptor on a human cell. In some embodiments, the Fc domain is modified to decrease binding to FY receptors, complement proteins, or both. In some respects, binding to the Fc receptor is reduced by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% when compared to a control molecule. In some aspects, the hybrid nuclease molecule has about 3-5 times or at least 3 times reduced cytotoxicity when compared to a hybrid nuclease molecule having an unmodified Fc domain (for example, an allele-wild Fc domain).
[0018] In some embodiments, the serum half-life of the molecule is significantly greater than the half-life of the first nuclease domain alone. In some embodiments, the nuclease activity of the first nuclease domain of the molecule is the same or greater than the nuclease domain alone. In some embodiments, administration of the molecule to a mouse increases the mouse's survival rate as measured by an animal Lupus model analysis. In other respects, the hybrid nuclease molecule degrades RNA, DNA, or both in immune complexes. In some embodiments, the hybrid nuclease molecule inhibits the production of interferon-α. In some aspects, interferon-α production is reduced by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% when compared to a control molecule.
[0019] In some embodiments, a hybrid nuclease molecule includes a leader sequence. In some embodiments, the leader sequence is a human VK3LP peptide from a human kappa light chain family, and the leader sequence is coupled to the N-terminus of the first nuclease domain. In the embodiments, the VK3LP has the sequence represented in SEQ ID NO: 100.
[0020] In some embodiments, the molecule is a polypeptide. In some embodiments, the molecule is a polynucleotide.
[0021] In some embodiments, the first nuclease domain comprises an RNase. In some embodiments, RNase is a human RNase. In some embodiments, RNase is a polypeptide comprising an amino acid sequence at least 90% identical to an RNase amino acid sequence shown in Table 1. In some embodiments, RNase is a member of the human RNase A family. In some embodiments, RNase is a human pancreatic RNase 1.
[0022] In some embodiments, the first nuclease domain comprises a DNase. In some embodiments, DNase is a human DNase. In some embodiments, DNase is a polypeptide comprising an amino acid sequence at least 90% identical to a DNase amino acid sequence shown in Table 1. In some embodiments, DNase is selected from the group consisting of human DNase I, TREX1, and human DNase 1L3.
[0023] In some embodiments, the Fc domain is a human Fc domain. In some embodiments, the Fc domain is a mutant Fc domain comprising SSS, P238S, and / or P331S. In some embodiments, the Fc domain is a human IgG1 Fc domain. In some embodiments, the Fc domain is a polypeptide comprising an amino acid sequence at least 90% identical to an amino acid sequence of the Fc domain represented in table 1.
[0024] In some embodiments, the first linker domain is about 1 to about 50 amino acids long. In some embodiments, the first linker domain is about 5 to about 31 amino acids long. In some embodiments, the first linker domain is about 15 to about 25 amino acids in length. In some embodiments, the first linker domain is about 20 to about 32 amino acids in length. In some embodiments, the first linker domain is about 20 amino acids in length. In some embodiments, the first linker domain is about 25 amino acids long. In some embodiments, the first linker domain is about 18 amino acids in length. In some embodiments, the first linker domain comprises a glycoside peptide. In some embodiments, the gli / ser peptide is of the formula (Gli4Ser) n, where n is a positive integer selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. In some embodiments, the gli / ser peptide includes (Gli4Ser) 3. In some embodiments, the gli / ser peptide includes (Gli4Ser) 4. In some embodiments, the gli / ser peptide includes (Gli4Ser) 5. In some embodiments, the first linker domain includes at least one restriction site. In some embodiments, the first linker domain includes about 12 or greater nucleotides including at least one restriction site. In some embodiments, the first linker domain includes two or more restriction sites. In some embodiments, the first linker domain includes a plurality of restriction sites. In some embodiments, the first linker domain comprises an NLG peptide. The NLG peptides contain a consensus N-linked glycosylation sequence. In one embodiment, the NLG peptide has a sequence represented at SEQ ID NO: 99. In some embodiments, the first linker domain comprises a glycosylation site linked to N.
[0025] In some embodiments, the first nuclease domain is linked to the N-terminus of the Fc domain. In some embodiments, the first nuclease domain is linked to the C-terminus of the Fc domain.
[0026] In some embodiments, the hybrid nuclease molecule further includes a second nuclease domain. In some embodiments, the first and the second nuclease domains are distinct from the nuclease domains. In some embodiments, the first and second nuclease domains are the same nuclease domains. In some embodiments, the second nuclease domain is linked to the N-terminus of the Fc domain. In some embodiments, the second nuclease domain is linked to the C-terminus of the first nuclease domain. In some embodiments, the second nuclease domain is linked to the N-terminus of the first nuclease domain.
[0027] Also described here is a dimeric polypeptide comprising a first polypeptide and a second polypeptide, where the first polypeptide comprises a first nuclease domain, and an Fc domain, where the first nuclease domain is operably coupled to the Fc domain. In some embodiments, the second polypeptide is a second hybrid nuclease molecule comprising a second nuclease domain, and a second Fc domain, where the second nuclease domain is operably coupled to the second Fc domain.
[0028] Also described herein is a pharmaceutical composition comprising at least one hybrid nuclease molecule and / or at least one dimeric polypeptide as described herein, and a pharmaceutically acceptable excipient.
[0029] Also described here is a nucleic acid molecule encoding a hybrid nuclease molecule. Also described herein is a recombinant expression vector comprising a nucleic acid molecule. Also described here is a host cell transformed with a recombinant expression vector described here.
[0030] Also described here is a method for making a hybrid nuclease described here, comprising the provision of a host cell containing a nucleic acid sequence that encodes the hybrid nuclease molecule; and maintaining the host cell under conditions in which the hybrid nuclease molecule is expressed.
[0031] Also described here is a method for treating or preventing a condition associated with an abnormal immune response, comprising administering to a patient in need of an effective amount of a hybrid nuclease molecule isolated here. In some embodiments, the condition is an autoimmune disease. In some embodiments, autoimmune disease is selected from the group consisting of insulin-dependent diabetes mielitus, multiple sclerosis, experimental autoimmune encephalomyelitis, rheumatoid arthritis, experimental autoimmune arthritis, myasthenia gravis, thyroiditis, an experimental form of uveoretinitis, Hashimoto's thyroiditis, primary myxoedema, thyrotoxicosis, pernicious anemia, autoimmune atrophic gastritis, Addison's disease, premature menopause, male infertility, juvenile diabetes, Goodpasture's syndrome, Pemphigus vulgaris, pemphigoid, sympathetic ophthalmia, facogenic uveitis, autoimmune hemolytic anemia, idiopathic biliary disease, leukemia , chronic active hepatitis Hbs-ve, cryptogenic cirrhosis, ulcerative colitis, Sjogren's syndrome, scleroderma, Wegener's granulomatosis, polymyositis, dermatomyositis, discoid LE, systemic lupus erythematosus (SLE), and connective tissue disease. In some embodiments, the autoimmune disease is SLE.
[0032] Also described is a method for treating SLE comprising administering to a subject a composition containing nuclease in an amount effective to degrade immune complexes containing RNA, DNA or both, RNA and DNA. In some aspects, the composition includes a pharmaceutically acceptable carrier and a hybrid nuclease molecule as described herein. In other aspects, the composition includes a hybrid nuclease molecule comprising an amino acid sequence represented in SEQ ID NOs: 62, 64, 66, 68, 70, 78, 80, 82, 84, 86, 92, 94, 96, or 98. Brief description of the various views of the drawings
[0033] These and other figures, aspects, and advantages of the present invention will become better understood in relation to the following description, and accompany the drawings, where:
[0034] Figure 1 illustrates a prototype structure for creating different configurations of the hybrid nuclease molecule;
[0035] Figure 2 illustrates the concentration of RSLV-124 recovered from the mouse serum after a single intravenous injection;
[0036] Figure 3 illustrates the result of an analysis of RNase enzyme activity on RLSV-12 recovered from mouse serum as measured in relative fluorescence unit (RFU’s) over time;
[0037] Figure 4 illustrates the concentration of RSLV-124 in mouse serum as extrapolated from the molecule's RNase enzyme activity;
[0038] Figure 5 illustrates the analysis of the diffusion of the single radial enzyme (SRED) from serum from two transgenic RNase (Tg) mice compared to a normal B6 mouse;
[0039] Figure 6 illustrates the concentration of RNase A in Tg and double Tg (DTg) in mice measured by ELISA. Each point represents the concentration measured in an individual mouse;
[0040] Figure 7 illustrates the survival of TLR7.1 Tg versus TLR7.1xRNase A DTg in mice;
[0041] Figure 8 illustrates the amount of CRP of IRGs in the spleen of TG versus DTg in mice;
[0042] Figure 9 illustrates the Western Blot on COS transfection supernatants from the construct RSLV 125-129 (SEQ ID NOs: 208-217);
[0043] Figure 10 illustrates the SRED analysis comparing the aliquots of the purified protein proteins from the transfected Cos supernatants RSLV;
[0044] Figure 11a-c illustrates the results of an analysis of DNase nuclease activity performed on protein protein purified from COS7 supernatants transfected with RSLV fusion plasmids;
[0045] Figure 12 illustrates the RFU (relative fluorescence units) as a function of time for each protein;
[0046] Figure 13 illustrates a Lineweaver Burk point of different tested molecules;
[0047] Figure 14 illustrates the data of the cytotoxicity graph in percentage of dead cells as a function of concentration of the fusion protein for RNaseIg molecules with a wild-type allele or the mutant Fc domain;
[0048] Figure 15 illustrates the histogram of the THP-1 coating of the stained cells after 72 hours;
[0049] Figure 16 illustrates the ability of RSLV-132 to inhibit the production of interferon-α induced by the immune complexes of SLE patients;
[0050] Figure 17 illustrates the in vivo ability of RSLV-132 to inhibit RNA-induced interferon-α production;
[0051] Figure 18 illustrates an evaluation of the RNAse enzymatic activity of two points of RSLV-132 production having been stored for up to 8 weeks at 4 ° C, compared to that of allele-wild RNase and RSLV-124;
[0052] Figure 19 illustrates an evaluation of the RNase enzymatic activity of RSLV-133, RSLV-123 and RSLV-124 in relation to that of RNase A as measured in RFUs over time;
[0053] Figure 20 illustrates an assessment of the enzyme activity of DNase from RSLV-133, and RSLV-123 in relation to that of DNase 1 as measured in RFUs over time;
[0054] Figure 21 illustrates the results of a gel digestion experiment comparing with the ability of RSLV-133 to digest DNA in relation to RSLV-123 and allele-wild DNase 1; and
[0055] Figure 22 illustrates the binding of RSLV-124 and RSLV-132 to the Fc receptor influencing THP1 cells through the FACS analysis of the mean fluorescence intensity measurement. Detailed Description
[0056] Systemic lupus erythematosus (SLE) is a multi-systemic autoimmune disease characterized by the presence of high titers of autoantibodies directed against auto-nucleoproteins. There is strong evidence that defective release or processing of dead cells or cells dying in SLE leads to disease, predominantly through the accumulation of ribo- and deoxi- (shortened nucleoprotein) ribonucleoproteins. Nucleoproteins cause damage through three mechanisms: (i) activation of the innate immune system to produce inflammatory cytokines; (ii) it serves as an antigen to generate circulatory immune complexes; and (iii) serves as antigens to produce complex formation in situ at local sites such as the kidney. The present invention is based, at least in part, on the discovery that digestion of extracellular nucleic acids has a therapeutic effect in vivo.
Consequently, the present invention provides methods for treating diseases characterized by defective release or processing of apoptotic cells and cellular waste, such as SLE, by administering an effective amount of nuclease activity to degrade extracellular RNA and DNA containing complex. Said treatments can inhibit the production of Type I interferon (IFNs) which are cytokines predominant in SLE and are strongly correlated with disease activity and nephritis.
[0058] In one embodiment, an individual is treated by administering a nuclease activity which is a DNase activity or an RNase, preferably in the form of a hybrid nuclease molecule. In one aspect, nuclease activity is a first nuclease domain. In another aspect, the nuclease domain is coupled to a modified Fc domain such that the molecule has reduced cytotoxicity. In one aspect, a hybrid nuclease molecule includes a second nuclease domain.
[0059] In another aspect, a method of treating SLE is provided in which an effective amount of a nuclease-containing composition is administered to an individual. In one aspect, the treatment results in the breakdown of immune complexes containing RNA, DNA or both RNA and DNA. In another aspect, treatment results in the inhibition of type I interferon, such as interferon-α in an individual. In one aspect, a method for treating an individual comprising administering an effective amount of a hybrid nuclease molecule composition comprising an amino acid sequence represented in SEQ ID NOs: 62, 64, 66, 68, 70, 78, 80, 82, 84, 86, 92, 94, 96 or 98. In another aspect, the composition is a hybrid nuclease molecule comprising an amino acid sequence represented by SEQ ID NO: 96 or 98.
[0060] The terms used in the claims and specifications are defined as represented below unless otherwise specified. In this case, the conflict is directed with a term used in a provisional patent application, the term used in the report examples to be controlled.
[0061] "Amino acids" refer to naturally occurring amino acids and synthetic amino acids, as well as amino acid analogues and amino acid mimetics that work in a similar way to naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are subsequently modified, for example, hydroxyproline, Y-carboxyglutamate, and O-phosphoserine. Amino acid analogs refer to compounds that have the same basic chemical structure as a naturally occurring amino acid, that is, an α carbon that is attached to a hydrogen, a carboxyl group, an amino group, and an R group, for example , homoserine, norleucine, methionine sulfoxide, methyl methionine sulfonium. Said analogs have the modified R group (e.g., norleukin) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refer to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that works in a similar way to a naturally occurring amino acid.
[0062] Amino acids can be referred to here either by their three commonly known symbol letters or by a symbol letter recommended by the IUPAC-IUB of the Biochemical Nomenclature Commission (“IUPAC-IUB Biochemical Nomenclature Commision”). Nucleotides, likewise, can be referred to by their commonly accepted single-letter codes.
[0063] An "amino acid substitution" refers to the replacement of at least one existing amino acid residue in a predetermined amino acid sequence (an amino acid sequence of an initial polypeptide) with a second, different "replacement" amino acid residue. An "amino acid insert" refers to the incorporation of at least one additional amino acid into a predetermined amino acid sequence. Although the insertion usually consists of the insertion of one or two amino acid residues, the current larger “peptide insertions” can be made, for example, from the insertion of about three to about five or even up to ten, fifteen, or twenty amino acid residues. The inserted residues can be naturally occurring or non-naturally occurring as described above. An "amino acid deletion" refers to the removal of at least one amino acid residue from a sequence of predetermined amino acids.
[0064] "Polypeptide", "peptide", and "protein" are used interchangeably here to refer to a polymer of amino acid residues. The terms applied to amino acid polymers in which one or more of the amino acid residues is an artificial chemical mimetic of an amino acid of a naturally occurring correspondent, as well as naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.
[0065] The "nucleic acid" refers to deoxyribonucleotides or ribonucleotides and polymers of the same in the form of single and double strands. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have binding properties similar to those of the reference nucleic acid and are metabolized in a similar manner to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementation sequences, as well as the sequence explicitly indicated. Specifically, replacements of the degeneration codon can be achieved by the generating sequences in which the third position of one or more of the selected codons (or all) is replaced with deoxinosine or mixed-base residues (Batzer et al., “Nucleic Acid Res . ”, 19: 5081, 1991; Ohtsuka et al., J. Biol. Chem., 260: 2605-2608, 1985); and Cassol et al., 1992; Rossolini et al., “Mol. Cell. Probes ”, 8: 91-98, 1994). For arginine and leucine, modifications to the second base can also be conservative. The term nucleic acid is used interchangeably with the gene, cDNA, and mRNa encoded by a gene.
[0066] The polynucleotides of the present invention can be composed of any polyribonucleotide or polydeoxyribonucleotide, which can be unmodified RNA or DNA or modified RNA or DNA. For example, polynucleotides can be composed of single-stranded or double-stranded DNA which is a mixture of single-stranded and double-stranded regions, single-stranded and double-stranded RNA, and RNA which is a mixture of single-stranded and double-stranded regions. double-stranded, hybrid molecules comprising DNA and RNA that can be single or double or, more typically, double-stranded or a mixture of single-stranded and double-stranded regions. In addition, the polynucleotide can be composed of triple strand regions comprising RNA or DNA or both RNA and DNA. A polynucleotide can also contain one or more modified bases or main strands of DNA or RNA modified for stability or for other reasons. "Modified" bases include, for example, trityl bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus, "polynucleotide" encompasses chemically, enzymatically, or metabolically modified forms.
[0067] As used herein, the term "hybrid nuclease molecule" refers to polynucleotides or polypeptides that comprise at least one nuclease domain and at least one Fc domain. The hybrid nuclease molecules are also referred to as fusion proteins and fusion genes. For example, in one embodiment, a hybrid nuclease molecule can be a polypeptide comprising at least one Fc domain linked to a nuclease domain such as DNase and / or RNase. As another example, a hybrid nuclease molecule can include an RNase nuclease domain, a binding domain, and an Fc domain. Examples of hybrid nuclease molecules include SEQ ID NO: 62, 64, 66, 68, 70, 78, 80, 82, 84, 86, 92, 96 and 98. Other examples are described in greater detail below. In one embodiment, a hybrid nuclease molecule of the invention can include additional modifications. In another embodiment, a hybrid nuclease molecule can be modified by adding a functional moiety (for example, PEG, a drug, or a marker).
[0068] As used herein, a "bispecific hybrid nuclease molecule", or "binuclease molecule" refers to a hybrid nuclease molecule with 2 or more nuclease domains, for example, a DNase domain and an RNase domain.
[0069] In certain respects, the hybrid nuclease molecules of the invention may employ one or more "binding domains", such as peptide ligands. As used here, the term "binding domain" refers to a sequence that connects two or more domains in a linear sequence. As used herein, the term "polypeptide linker" refers to a peptide or polypeptide sequence (for example, a synthetic peptide or polypeptide sequence) that connects to two or more domains in a linear amino acid sequence of a chain of polypeptide. For example, polypeptide ligands can be used to connect a nuclease domain to an Fc domain. Preferably, such a polypeptide ligand can provide flexibility to the polypeptide molecule. In certain embodiments, the polypeptide ligand is used to connect (e.g., genetically fuse) one or more Fc domains and / or one or more nuclease domains. A hybrid nuclease molecule of the invention may comprise more than one binding domain or a peptide linker.
[0070] As used here, the term "glyph-polypeptide ligand" refers to a peptide consisting of glycine and serine residues. An exemplary gli / ser polypeptide linker comprises the amino acid sequence Ser (Gli4Ser) n. In one embodiment, n = 1. In one embodiment, n = 2. In another embodiment, n = 3, that is, Ser (Gli4Ser) 3). In another embodiment, n = 4, that is, Ser (Gli4Ser) 4. In yet another embodiment, n = 5. In yet another embodiment, n = 6. In another embodiment, n = 7. In yet another embodiment, n = 8. In another embodiment, n = 9. Yet another embodiment, n = 10. Another example of a glyc / ser polypeptide linker comprises the amino acid sequence Ser (Gli4Ser) n. In one embodiment, n = 1. In another embodiment, n = 2. In a preferred embodiment, n = 3. In another embodiment, n = 4. In another embodiment, n = 5. In yet another embodiment, n = 6.
[0071] As used here, the terms "linked", "fused", or "merger", are used interchangeably. These terms refer to the joining together of two or more elements or components or domains, by any means including chemical conjugation or recombinant means. Chemical conjugation methods (for example, using hetero-bifunctional cross-linking agents) are known in the art.
[0072] As used here, the term "Fc region" should be defined as the portion of a native immunoglobulin formed by the respective Fc domains (or Fc portions) of its two heavy chains.
[0073] As used herein, the term "Fc domain" refers to a portion of a simple immunoglobulin (Ig) heavy chain, where the Fc domain does not comprise an Fv domain. As such, the Fc domain can also be referred to as "Ig" or "IgG". In some embodiments, an Fc domain starting at the hinge region just upstream of the papain cleavage site and ending at the C-terminus of the antibody. Consequently, a complete Fc domain comprises at least one hinge domain, a CH2 domain, and a CH3 domain. In certain embodiments, an Fc domain comprises at least one of: a hinge domain (for example, upper region, median region, and / or lower hinge region), a CH2 domain, a CH3 domain, a CH4 domain, or a variant portion, or fragment thereof. In other embodiments, an Fc domain comprises a complete Fc domain (i.e., a hinge domain, a CH2 domain, and a CH3 domain). In one embodiment, an Fc domain comprises a hinge domain (or portion thereof) fused to a CH3 domain (or portion thereof). In one embodiment, an Fc domain comprises a CH2 domain (or portion thereof) fused to a CH3 domain (or portion thereof). In another embodiment, an Fc domain consists of a CH3 domain or a portion thereof. In another embodiment, an Fc domain consists of an articulation domain (or portion thereof) and a CH3 domain (or portion thereof). In another embodiment, an Fc domain consists of a CH2 domain (or portion thereof) and a CH3 domain. In another embodiment, an Fc domain consists of an articulation domain (or portion thereof) and a CH2 domain (or portion thereof). In one embodiment, an Fc domain loses at least a portion of a CH2 domain (for example, all or part of a CH2 domain). In one embodiment, an Fc domain of the invention comprises at least the portion of an Fc molecule known in the art to be required for FcRn binding. In another embodiment, an Fc domain of the present invention comprises at least the portion of an Fc molecule known in the art to be required for FcYR binding. In one embodiment, an Fc domain of the invention comprises at least the portion of an Fc molecule known in the art to be required for protein A binding. In one embodiment, an Fc domain of the invention comprises at least the portion of a molecule Fc known in the prior art that will be required for protein G binding. An Fc domain here generally refers to a polypeptide comprising all or part of the Fc domain of an immunoglobulin heavy chain. This includes, but is not limited to, polypeptides comprising the entire CH1, joint, CH2, and / or domains, as well as fragments of said peptides comprising only, for example, the joint, CH2, and CH3 domains. The Fc domain can be derived from an immunoglobulin of any species and / or any subtype, including, but not limited to, an IgG1, IgG2, IgG3, IgG4, IgD, IgA, IgE, or human IgM antibody. The Fc domain comprises the native Fc and Fc variant molecules. When with the native Fc and Fc variants, the term Fc domain includes molecules in monomeric or multimeric form, whether digested from the whole antibody or produced by other means. The assignment of amino acid residue numbers to an Fc domain is in accordance with Kabat's definitions. See, for example, "Sequences of Proteins of Immunological Interest" (Table of Contents, Introduction and Sections of Constant Region Sequences), 5th Edition, Bethesda, MD: NIH volume 1: 647723 (1991); Kabat et al., "Introduction", "Sequences of Proteins of Immunological Interest", US Dept. of Health and Human Services, NIH, 5th edition, Bethesda, MD volume 1; xiii- xcvi (1991); Chothia & Lesk, “J. Mol. Biol. ”, 196: 901-917 (1987); Chothia et al., “Nature” 342: 878-883 (1989), each of which is incorporated herein by reference for all purposes.
[0074] As depicted here, it should be understood by one skilled in the art that any Fc domain can be modified so that it varies in the amino acid sequence from the native Fc domain of a naturally occurring immunoglobulin molecule. In certain exemplary embodiments, the Fc domain retains an effector function (for example, FcYR link).
The Fc domains of a polypeptide of the invention can be derived from different immunoglobulin molecules. For example, an Fc domain of a polypeptide can comprise a CH2 and / or CH3 domain derived from an IgG1 molecule and a hinge region derived from an IgG3 molecule. In another example, an Fc domain may comprise a chimeric hinge region derived, in part, from an IgG1 molecule and, in part, from an IgG3 molecule. In another example, an Fc domain can comprise a chimeric articulated derivative, partly from an IgG1 molecule and partly from an IgG4 molecule.
[0076] A polypeptide or amino acid sequence "derived from" a designated polypeptide or protein refers to the origin of the polypeptide. Preferably, the polypeptide or amino acid sequence that is derived from a particular sequence has an amino acid sequence that is essentially identical to that sequence or a portion thereof, the portion consisting of at least 10-20 amino acids, preferably at least 20 -30 amino acids, more preferably, at least 30-50 amino acids, or that is otherwise identifiable to a person skilled in the art as having their origin in the sequence.
[0077] Polypeptides derived from another peptide may have one or more mutations relative to the initial polypeptide, for example, one or more amino acid residues that have been replaced with another amino acid residue or that have one or more insertions or deletions of residues of amino acids.
[0078] A polypeptide can comprise a sequence of amino acids that is not naturally occurring. Said variants necessarily have less than 100% sequence identity or similarity to the initial hybrid nuclease molecules. In a preferred embodiment, the variant will have an amino acid sequence of about 75% less than 100% identity of the amino acid sequence or similarity to the amino acid sequence of the initial polypeptide, more preferably, about 80% unless 100%, more preferably, from about 85% to less than 100%, more preferably, from about 90% to less than 100% (e.g. 91%, 92%, 93%, 94%, 95%, 96 %, 97%, 98%, 99%) and more preferably from about 95% to less than 100%, for example, over the length of the variant molecule.
[0079] In one embodiment, there is an amino acid difference between an initial polypeptide sequence and the sequence derived therefrom. The identity or similarity with respect to this sequence is defined here as the percentage of amino acid residues in the candidate sequences that are identical (that is, the same residue) with the initial amino acid residues, after the alignment of the sequences and the introduction of intervals , if necessary, to achieve the maximum percentage of sequence identity.
[0080] In one embodiment, a polypeptide of the invention consists of, consists essentially of, or comprises an amino acid sequence selected from table 1 and functionally active variants thereof. In one embodiment, a polypeptide includes an amino acid sequence of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to an amino acid sequence shown in Table 1. In one embodiment, a polypeptide includes a continuous amino acid sequence of at least 80% , 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97 %, 98%, or 99% identity to a continuous amino acid sequence shown in Table 1. In one embodiment, a polypeptide includes an amino acid sequence having at least 10, 15, 20, 25, 30, 35, 40, 45 , 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, or 500 (or any integer within these numbers) continuous amino acids of an amino acid sequence represented in the Table 1.
[0081] In one embodiment, the peptides of the invention are encoded by a sequence of nucleotides. The nucleotide sequences of the invention can be useful for a number of applications, including, cloning, gene therapy, protein expression and purification, introduction of mutation, DNA vaccination of a host in need of it, generation of antibody by, for example, passive immunization, PCR, primer and probe generation, siRNA design and generation (see, for example, Dharmacon siDesign website), and the genus. In one embodiment, the nucleotide sequence of the invention comprises, consists of, or consists essentially of, a nucleotide sequence selected from Table 1. In one embodiment, a nucleotide sequence includes a nucleotide sequence of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% , or 99% identity for a nucleotide sequence represented in Table 1. In one embodiment, a nucleotide sequence includes a sequence of continuous nucleotides of at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a nucleotide sequence represented in Table 1. In one embodiment, a nucleotide sequence includes a nucleotide sequence having at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85 , 90, 95, 100, 200, 300, 400, or 500 (or any integer within these numbers) continuous amino acids those of an amino acid sequence represented in Table 1.
The preferred hybrid nuclease molecules of the invention comprise a sequence (e.g., at least one Fc domain) derived from a human immunoglobulin sequence. However, the sequences may comprise one or more sequences from another species of mammal. For example, a primate Fc domain or nuclease domain can be included in the object sequence. Alternatively, one or more murine amino acids can be present in a polypeptide. In some embodiments, the polypeptide sequences of the invention are not immunogenic and / or have reduced immunogenicity.
[0083] It should also be understood by one skilled in the art that the hybrid nuclease molecules of the invention can be altered so that they vary in the sequence of naturally occurring sequences or native sequences from which they were derived, while retaining the desired activity of the native strings. For example, nucleotide or amino acid substitutions leading to conservative substitutions or changes in “non-essential” amino acid residues can be made. An isolated nucleic acid molecule encoding an unnatural variant of an immunoglobulin-derived hybrid nuclease molecule (for example, an Fc domain) can be created by introducing one or more nucleotide substitutions, additions or deletions within the sequence immunoglobulin nucleotides so that one or more amino acid substitutions, additions or deletions are introduced into the encoded proteins. Mutations can be introduced by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis.
[0084] The peptide hybrid nuclease molecules of the invention may comprise substitutions of conservative amino acids in one or more amino acid residues, for example, in essential and non-essential amino acid residues. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (eg, lysine, arginine, histidine), acidic side chains (eg, aspartic acid, glutamic acid), non-polar side chains charged (e.g. glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (for example, threonine, valine, isoleucine) and aromatic side chains (for example, tyrosine, phenylalanine, tryptophan, histadine).
[0085] Thus, a non-essential amino acid residue in a binding polypeptide is preferably substituted with another amino acid residue from the same side chain family. In another embodiment, a series of amino acids can be replaced with a structurally similar series that differs in a way to and / or the composition of the members of the side chain family. Alternatively, in another embodiment, mutations can be introduced randomly over all or part of a coding sequence, such as saturation by mutagenesis, and the resulting mutants can be incorporated into polypeptide ligands of the invention and classified by their abilities connecting to the desired target.
[0086] The term "improvement" refers to any therapeutically beneficial outcome in the treatment of a disease state, for example, an autoimmune disease state (for example, SLE), including prophylaxis, reduction in severity or progression, remission, or cure.
[0087] The term "in situ" refers to the processes that occur in a living cell growing separate from a living organism, for example, growing in tissue culture.
[0088] The term "in vivo" refers to the processes that occur in a living organism.
[0089] The term "mammal" or "individual" or "patient" as used herein includes both humans and non-humans and includes, but is not limited to, humans, non-human primates, canines, felines, mice, cattle, horses, and swine (“porcines”).
[0090] The term "identity" percentage, in the context of two or more nucleic acids or polypeptide sequences, refers to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, when measured using one of the sequence comparison algorithms described below (for example, BLASTP and BLASTN or other algorithms available to those skilled in the art) or by visual inspection. Depending on the application, the percentage of "identity" may exist over a region of the sequence being compared, for example, over the functional domain, or alternatively, it exists over the full length of the two sequences to be compared.
[0091] For sequence comparison, typically a sequence acts as a reference sequence to which the test sequence is compared. When using a sequence comparison algorithm, the test and reference sequences are entered into a computer, the coordinates of the subsequences are designated, if necessary, and the parameters of the sequence algorithm program are designated. The sequence comparison algorithm then calculates the percentage of sequence identity for the test sequence relative to the reference sequence, based on the parameters of the designated program.
[0092] The optimal alignment of the sequences for comparison can be conducted, for example, through the local homology algorithm of Smith & Waterman, “Adv. Appl. Math. ”, 2, 482 (1981), through the homology alignment algorithm of Needleman & Wunsch.,“ J. Mol. Biol. ”, 48: 443 (1970), through the search for similarity methods by Pearson & Lipman,“ Proc. Nat’l. Acad. Sci. ”, USA 85: 2444 (1988), through the computerized implementation of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the“ Wisconsin Genetics Software ”package, Genetics Computer Group, 575 Science Dr. Madison, Wis), or through visual inspection (see generally, Ausubel et al., infra).
[0093] An example of an algorithm that is appropriate for determining the percentage of sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., “J. Mol. Biol. ”, 215: 403-410 (1990). The BLAST analysis performance software is publicly available through the website of the “National Center for Biotechnology Information”.
[0094] The term "sufficient amount" means an amount sufficient to produce a desired effect, for example, an amount sufficient to modulate protein aggregation in a cell.
[0095] The term "therapeutically effective amount" is an amount that is effective in ameliorating a symptom of a disease. A therapeutically effective amount can be a "prophylactically effective amount" when prophylaxis can be considered therapy.
[0096] It should be noted that, as used in the patent application and the attached claims, the singular forms "one", "one" and "the (a)" include reference in plural unless the context clearly dictates otherwise. Compositions: Hybrid nuclease molecules:
[0097] In some embodiments, a composition of the present invention includes a hybrid nuclease molecule. In some embodiments, a hybrid nuclease molecule includes a nuclease domain operably linked to an Fc domain. In some embodiments, a hybrid nuclease molecule includes a nuclease domain linked to an Fc domain. In some embodiments, the hybrid nuclease molecule is a nuclease protein. In some embodiments, the hybrid nuclease molecule is a nuclease polynucleotide.
[0098] In some embodiments, the nuclease domain is linked to the Fc domain via a binding domain. In some embodiments, the binding domain is a peptide linker. In some embodiments, the binding domain is a linker nucleotide. In some embodiments, the hybrid nuclease molecule includes a leader molecule, for example, a leader peptide. In some embodiments, the leader molecule is a leader peptide positioned at the N-terminus of the nuclease domain. In some embodiments, the hybrid nuclease molecule of the invention comprises a leading peptide at the N-terminus of the molecule, where the leading peptide is later cleaved from the hybrid nuclease molecule.
[0099] Methods for producing nucleotide sequences encoding a leader peptide fused to a recombinant protein are well known in the art. In one embodiment, any of the hybrid nuclease molecules of the present invention can be expressed both with and without a leader fused to its N-terminus. The protein sequence of a hybrid nuclease molecule of the present invention following the cleavage of a fused leader peptide can be predictable and / or deduced by one skilled in the art. Examples of hybrid nuclease molecules of the present invention additionally include a leader peptide VK3 (VK3LP), where the leader peptide is fused to the N-terminus of the hybrid nuclease molecule, are represented in SEQ ID NOs: 93 (RSLV-132) and 94 (RSLV-133). The corresponding nucleotide sequences are represented in SEQ ID NOs: 91 and 93, respectively. In embodiments, after cleavage of the leader VK3, these hybrid nuclease molecules have the sequences as represented in SEQ ID NOS: 96 (RSLV-132) and 98 (RSLV-133), respectively. The corresponding nucleotide sequences are represented in SEQ ID NOS: 95 and 97, respectively. In some embodiments, a hybrid nuclease molecule of the present invention is expressed without a leading peptide fused to its N-terminus, and the resulting hybrid nuclease molecule has a methionine at the N-terminus.
[0100] In some embodiments, the hybrid nuclease molecule will include a stop codon. In some embodiments, the stop codon will be at the C-terminal of the Fc domain.
[0101] In some embodiments, the hybrid nuclease molecule further includes a second nuclease domain. In some embodiments, the second nuclease domain is linked to the Fc domain via a second binding domain. In some embodiments, the second linking domain will be at the C-terminal of the Fc domain. Figure 1 illustrates at least one embodiment of a hybrid nuclease molecule. In some embodiments, a hybrid nuclease molecule includes a sequence shown in Table 1.
[0102] In some embodiments, a hybrid nuclease molecule is an RNase molecule or a DNase molecule or a multiple enzyme molecule (for example, both RNase and DNase or two RNA or DNA nucleases with different substrate specificities) linked to an Fc domain that specifically binds to extracellular immune complexes. In some embodiments, the Fc domain does not actually bind to the FcY receptors. In one aspect, the hybrid nuclease molecule does not bind effectively to C1q. In other respects, the hybrid nuclease molecule comprises one in the structure of the Fc domain from IgG1. In another aspect, the hybrid nuclease molecule further comprises mutations in the joint, in the CH2, and / or CH3 domains. In another aspect, the mutations are P238S, P331S, or N297S, and can include mutations in one or more of the three cysteine joints. In some of the respective aspects, mutations in one or more of the three cysteine joints can be SCC or SSS. In another aspect, the molecules contain the SCC joint, but are otherwise allele-wild for the IgG1 Fc CH2 and CH3 domains, and effectively binds to the Fc receptors, facilitating the understanding of the hybrid nuclease molecule in endocytic cell compartments for to which they are connected. In another aspect, the molecule has activity against double-stranded and / or single-stranded RNA substrates.
[0103] In some respects, a hybrid nuclease molecule includes a mutant Fc domain. In some respects, a hybrid nuclease molecule includes a mutant IgG1 Fc domain. In some aspects, a mutant Fc domain comprises one or more mutations in the articulation of the CH2 and / or CH3 domains. In some respects, a mutant Fc domain includes a P238S mutation. In some respects, a mutant Fc domain includes a P331S mutation. In some respects, a mutant Fc domain includes a P238S mutation and a P331S mutation. In some respects, a mutant Fc domain comprises P238S and / or P331S, and can include mutations in one or more of the three cysteine joints. In some respects, a mutant Fc domain comprises P238S and / or P331S, and / or one or more mutations in the three cysteine joints. In some respects, a mutant Fc domain comprises P238S and / or P331S, and / or mutations in the three cysteine joints for SSS or in one cysteine joint for SCC. In some respects, a mutant Fc domain comprises P238S and P331S and mutations in the three cysteine joints. In some respects, a mutant Fc domain comprises P238S and P331S and either SCC or SSS. In some respects, a mutant Fc domain comprises P238S and P331S and SCC. In some respects, a mutant Fc domain includes P238S and SSS. In some respects, a mutant FC domain includes P331S and either SCC or SSS. In some respects, a mutant FC domain includes mutations in one or more of the three cysteine joints. In some respects, a mutant Fc domain includes mutations in the three cysteine joints. In some respects, a mutant Fc domain includes mutations in the three cysteine joints for SSS. In some respects, an Fc domain includes mutations in one of the three cysteine joints for SCC. In some respects, a mutant Fc domain includes SCC or SSS. In some respects, a mutant Fc domain is as shown in any of SEQ ID NOS: 59, 60, 7176, or 87-90. In some respects, a hybrid nuclease molecule is as shown in any of SEQ ID NOS: 62, 64, 66, 68, 70, 78, 80, 82, 84, 86, 92, 94, 96 or 98. In some aspects, a hybrid nuclease molecule comprises a human allele-wild RNase 1 domain linked to a mutant human IgG1 Fc domain comprising SCC, P238S, and P331S, or a mutant human IgG1 Fc domain comprising SSS, P238S and P331S. In some respects, a nucleic acid sequence encoding a hybrid nuclease molecule is as shown in SEQ ID NO: 61.77, or 91. In some aspects, a hybrid nuclease molecule is shown in SEQ ID NO: 62, 78 , 92, or 96.
[0104] In some respects, a hybrid nuclease molecule comprises a human allele-wild RNase 1 domain linked via a linker (Gli4Ser) 4 domain to a mutant, human IgG1 Fc domain comprising SCC, P238S, and P331 or an IgG1 Fc domain mutant human comprising SSS, P238S, and P331S. In some respects, a nucleic acid sequence encoding a hybrid nuclease molecule is shown in SEQ ID NOs: 63 OR 79. In some aspects, a hybrid nuclease molecule is shown in SEQ ID NOS: 64, or 80.
[0105] In some respects, a hybrid nuclease molecule comprises a human DNase G105R A114F domain linked via a linker domain (Gli4Ser) 4 to a mutant, human IgG1 Fc domain comprising SCC, P238S, and P331S linked via an NLG linker domain to an allele-wild human RNAse 1 domain. In some respects, a hybrid nuclease molecule comprises a human DNase 1 G105R A114F domain linked via a linker domain (Gli4Ser) 4 to a mutant, human IgG1 Fc domain comprising SSS, P238S, and P331S linked via an NLG linker domain to a domain Allele-wild human RNase 1. In some respects, a nucleic acid sequence encoding a hybrid nuclease molecule is shown in SEQ ID NOS: 65, or 81. In some aspects, a hybrid nuclease molecule is shown in SEQ ID NO: 66, or 82.
[0106] In some respects, a hybrid nuclease molecule comprises a human allele-wild RNase 1 domain linked via a linker (Gli4Ser) 4 domain to a mutant, mutant human IgG1 Fc domain comprising SCC, P238S, and P331S linked via a domain NLG linker for a human G115R A114F DNAse 1 domain. In some aspects, a hybrid nuclease molecule comprises a human allele-wild RNase 1 domain linked via a linker (Gli4Ser) 4 domain to a mutant, the human IgG1 Fc domain comprising SSS, P238S, and P331S linked via an NLG linker domain for a human G105R A114F DNase 1 domain. In some respects, a nucleic acid sequence encoding a hybrid nuclease molecule is shown in SEQ ID NOS: 67, or 83. In some aspects, a hybrid nuclease molecule is shown in SEQ ID NOS: 68 or 84.
[0107] In some respects, a hybrid nuclease molecule comprises a human allele-wild RNAse 1 domain bound to a mutant, human IgG1 Fc domain comprising SCc, P238S, and P331S linked via an NLG domain linker to a G105R A114F DMNase domain human. In some aspects, a hybrid nuclease molecule comprises a human allele-wild RNAse 1 domain linked to a mutant human IgG1 Fc domain comprising SSS, P238S, and P331S linked via an NLG domain linker to a human G105R A114F domain. In some respects, a nucleic acid sequence encoding a hybrid nuclease molecule is shown in SEQ ID NOS: 69, 85 or 93. In some aspects, a hybrid nuclease molecule is shown in SEQ ID NOS: 70, 86, 94 or 98.
[0108] In some respects, the activity of the hybrid nuclease molecule is detectable in vitro and / or in vivo. In some ways, the hybrid nuclease molecule binds to a cell, a malignant cell, or a cancer cell and interferes with its biological activity.
[0109] In another aspect, a multifunctional RNase molecule is provided so that it is linked to another enzyme or an antibody having binding specificity, such as an RNA target scFv or a second nuclease domain with the same specificities or with different specificities like the first domain.
[0110] In another aspect, a multifunctional DNase molecule is provided so that it is linked to another enzyme or antibody having binding specificity, such as a target scFv for DNA or a second nuclease domain with the same specificity or a different specificity like that of the first domain.
[0111] In another aspect, a hybrid nuclease molecule is adapted to prevent or treat a disease or disorder in a mammal by administering a hybrid nuclease molecule linked to an Fc region, in a therapeutically effective amount for the mammal needing it, where the disease is prevented or treated. In another aspect, the disease or disorder is an autoimmune disease or cancer. In some of these aspects, the autoimmune disease is insulin-dependent diabetes mielitus, multiple sclerosis, experimental autoimmune encephalomyelitis, rheumatoid arthritis, experimental autoimmune arthritis, myasthenia gravis, thyroiditis, an experimental form of uveoretinitis, Hashimoto's thyroiditis, primary myxoedema, thyroid toxicosis pernicious anemia, atrophic autoimmune gastritis, Addison's disease, premature menopause, male infertility, juvenile diabetes, Goodpasture's syndrome, Pemphigus vulgaris, pemphigoid, sympathetic ophthalmia, phageogenic uveitis, autoimmune hemolytic anemia, idiopathic leukopenia, primary biliary cirrhosis -ve, cryptogenic cirrhosis, ulcerative colitis, Sjogren's syndrome, scleroderma, Wegener's granulomatosis, polymyositis, dermatomyositis, LE discoid, systemic lupus erythematosus (SLE), and connective tissue disease.
[0112] In some embodiments, targets for the RNase enzyme activity of the RNase hybrid nuclease molecules are primarily extracellular, consisting of, for example, RNA contained in immune complexes with anti-RNAP autoantibody and RNA expressed on the surfaces of cells passing through by apoptosis. In some embodiments, the hybrid RNAse nuclease molecule is active in the acidic environment of the endocytic vesicles. In some embodiments, a hybrid RNase nuclease molecule includes an allele-wild Fc (wt) domain in order, for example, to allow the molecule to bind FcR and enter the endocytic compartment by entering the route used by the immune complexes. In some embodiments, an RNase hybrid nuclease molecule including an Fc wt domain is adapted to be active in both, extracellularly and in the endocytic medium (where TLR7 can be expressed). In some ways, this allows for a hybrid RNase nuclease molecule including an Fc wt domain to interrupt TLR7 signaling through previously engulfed by the immune complex or the RNAs that activate TLR7 after viral infection. In some embodiments, the RNase wt of an RNase hybrid nuclease molecule is not resistant to inhibiting a RNAse cytoplasmic RNAse inhibitor. In some embodiments, the wt RNAse of an RNase hybrid nuclease molecule is not active in the cytoplasm of a cell.
[0113] In some embodiments, a hybrid nuclease molecule including an Fc wt domain is used for the therapy of an autoimmune disease, for example, SLE.
[0114] In some embodiments, the Fc domain of Fc receptor binding (FcR) is increased, for example, via changes in glycosylation and / or changes in the amino acid sequence. In some embodiments, a hybrid nuclease molecule has one or more Fc changes that increase the FcR bond.
[0115] Alternative ways to build a hybrid nuclease molecule linked to an Fc domain are predicted. In some embodiments, the orientation of the domain can be changed to construct an Ig-RNase molecule or an Ig-DNase molecule or an Rnase-Ig molecule or an RNase-Ig molecule that retains the FcR bond and has active nuclease domains.
[0116] In some embodiments, the hybrid nuclease molecule DNase includes an Fc wt domain that can allow, for example, molecules to transmit endocytosis after FcR binding. In some embodiments, the DNase hybrid nuclease molecules can be active in relation to extracellular immune complexes containing DNA, for example, both in soluble and deposited form as insoluble complexes.
[0117] In some embodiments, the hybrid nuclease molecules include both DNase and RNase. In some embodiments, these hybrid nuclease molecules can improve SLE therapy because they can, for example, be digestive immune complexes containing RNa, DNas, or a combination of both RNA and DNAs; and when they still include a wt Fc domain, they are active in both extracellularly and in the endocytic compartment where TLR7 and TLR9 can be located.
[0118] In some embodiments, the linker domains include (gli4ser) 3, 4, or 5 variants that alter the length of the linker through 5 amino acid progressions. In other embodiments, a linker domain is approximately 18 amino acids in length and includes an N-linked glycosylation site, which may be sensitive to protease cleavage in vivo. In some embodiments, an N-linked glycosylation site can protect hybrid nuclease molecules from cleavage in the ligand domain. In some embodiments, an N-linked glycosylation site may assist in the separation of folds from the separate functional domains separated through the ligand domain.
[0119] In some embodiments, the hybrid nuclease molecules can include both the mutant IgG1 Fc and / or human wild-allele domains. In some embodiments, the hybrid nuclease molecules can be expressed in both, in the stable transient CHO and COS transfections. In some embodiments, both the CD80 / 86 bond and RNase activity are conserved in a hybrid nuclease molecule. In some embodiments, the hybrid nuclease molecules include the DNase 1 L3-Ig-ligand-RNase constructs. In some embodiments, a hybrid nuclease molecule includes a DNAse 1-Ig-ligand-RNase construct or an RNase-Ig-ligand-DNase construct. In some embodiments, the fusion junctions between the enzyme domains and the other domains of the hybrid nuclease molecule are optimized.
[0120] In some embodiments, the hybrid nuclease and molecules include the DNase-Ig hybrid nuclease molecules and / or the DNase-RNase hybrid nuclease molecules.
[0121] In some embodiments, a hybrid nuclease molecule includes TREX1. In some embodiments, a TREX1 hybrid nuclease molecule can digest chromatin. In some embodiments, a hybrid nuclease molecule TREX1 is expressed by a cell. In some embodiments, the expressed hybrid nuclease molecule includes rat TREX-1 ("murine") and a rat Fc domain (wt or mutant). In some embodiments, an amino acid binding domain 2025 (aa) between TREX1 and the igG joint may be required to allow DNase activity. In some embodiments, a hybrid nuclease molecule with a 15 aa ligand domain is not active. In some embodiments, the use of amino acid ligand domains 20 and 25 (plus 2 or more amino acids to incorporate the restriction sites) result in functional activity as measured by chromatin digestion. In some embodiments, a hydrophobic region of approximately 72 aa can be removed from final COOH and TREX-1 prior to fusion to the Fc domain via the ligand domain. In some embodiments, a 20 amino acid linker domain version of the hybrid nuclease molecule exhibits high levels of expression compared to controls and / or other hybrid nuclease molecules. In some embodiments, kinetic enzyme analysis is used to compare the enzymatic activity of hybrid nuclease molecules and controls it in a quantitative manner.
[0122] In some embodiments, further optimization of the chosen fusion junction for truncated by a TREX1 enzyme can be used to improve the expression of the hybrid nuclease molecules.
[0123] In some embodiments, the hybrid nuclease molecule includes a hybrid nuclease molecule from the TREX-1-ligand-Ig Fc domain with a 20 and / or 25 aa binding domain. In some embodiments, the linker domains are variants of a (gli4ser) or (gli4ser) 5 cassette with one or more restriction sites linked for incorporation into the hybrid nuclease molecule construct. In some embodiments, due to the dimerization of the head, the syrup useful for the enzymatic activity TREX1; a larger flexible binder domain can be used to facilitate proper folding.
[0124] In some embodiments, the hybrid nuclease molecule is a TREX1-tandem hybrid nuclease molecule. In some embodiments, an alternative method of facilitating TREX1 head-to-tail folding is to generate a hybrid nuclease molecule TREX1-TREX1-Ig that incorporates two TREX1 domains in tandem, followed by a ligand domain and an Ig Fc domain. In some embodiments, the positioning of TREX1 cassettes in a head-to-tail manner can be corrected to fold the head-tail both over the immunoenzyme arm and introduce a unique TREX1 functional domain within each arm of the molecule. In some embodiments, each immunoenzyme of a hybrid nuclease molecule has two functional TREX1 enzymes linked to a single IgG Fc domain.
[0125] In some embodiments, the hybrid nuclease molecule includes TREX1-ligand 1-Ig-ligand 2-RNAse.
[0126] In some embodiments, the hybrid nuclease molecule includes RNase-Ig-ligand-TREX1. In some embodiments, cassettes are derived for both the amino and carboxyl fusion of each enzyme for incorporation into the hybrid nuclease molecules where the enzyme configuration is reversed. In some embodiments, the RNase enzyme has a comparable functional activity with respect to its position in the hybrid nuclease molecules. In some embodiments, the alternative hybrid nuclease molecule can be designed to test whether a particular configuration demonstrates improved expression and / or function of the components of the hybrid nuclease molecule.
[0127] In some embodiments, the hybrid nuclease molecule includes 1L3-Ig. In some embodiments, 1L3 DNase is constructed from a mouse sequence and expressed. In some embodiments, the enzyme is active. In some embodiments, a hybrid 1L3 mouse DNase-Ig-RNase nuclease is constructed and expressed. In some embodiments, the molecule includes human 1L3-Ig, human 1L3-Ig-RNase, and / or human RNAse-Ig-1L3.
[0128] In some embodiments, the hybrid nuclease molecule includes DNAse-1-Ig. In some embodiments, a naturally occurring variant allele, A114F, which allows for reduced sensitivity to actin is included in a hybrid DNase 1-Ig nuclease molecule. In some embodiments, this mutation is introduced into a hybrid nuclease molecule to generate a more stable derivative of human DNase 1. In some embodiments, a DNase 1-ligand-Ig containing a 20 or 25 aa binding domain is made. In some embodiments, hybrid nuclease molecules include RNase-Ig-ligand-DNase 1 where the DNase 1 domain is located on the COOH side of the Ig Fc domain. In some embodiments, the hybrid nuclease molecules are made so that they incorporate DNase 1 and include: DNase 1-ligand-Ig-ligand 2-RNase, and / or RNase-Ig-ligand-DNase 1.
[0129] Another aspect of the present invention is to use gene therapy methods for treating or preventing disorders, diseases, and conditions with one or more hybrid nuclease molecules. Gene therapy methods refer to the introduction of the nucleic acid sequences of the hybrid nuclease molecule (DNA, RNA and DNA or antisense RNA) into an animal to achieve expression of the polypeptide or polypeptides of the present invention. This method may include the introduction of one or more polynucleotides encoding a polypeptide of the hybrid nuclease molecule of the present invention operably linked to a promoter and any other genetic elements necessary for the expression of the polypeptide by the target tissue.
[0130] In gene therapy applications, hybrid nuclease molecule genes are introduced into cells in order to achieve in vivo synthesis of a therapeutically effective gene product. "Gene therapy" includes both conventional gene therapies where a lasting effect is achieved by a single treatment, and the administration of therapeutic gene agents, which involve time or repeated administration of a therapeutically effective DNA or mRNA. Oligonucleotides can be modified to increase their absorption, for example, by replacing their negatively charged phosphodiester groups with uncharged groups. Fc Domains:
[0131] In some embodiments, a hybrid nuclease molecule includes an Fc domain. The Fc domains do not contain a variable region that binds to an antigen. In the embodiments, the Fc domain does not contain a variable region. The Fc domains useful for producing the hybrid nuclease molecules of the present invention can be obtained from a number of different sources. In a preferred embodiment, an Fc domain of the hybrid nuclease molecule is derived from a human immunoglobulin. It is understood, however, that the Fc domain can be derived from an immunoglobulin of another species of mammal, including, for example, a rodent (for example, a mouse, rat, rabbit, guinea pig) or primate species non-human (eg chimpanzee, monkeys). In addition, the Fc domain of the hybrid nuclease molecule or portion thereof can be derived from any immunoglobulin class, including IgM, IgG, IgD, IgA, and IgE, and any immunoglobulin isotype, including IgG1, IgG2, IgG3 , and IgG4. In a preferred embodiment, human isotype IgG1 is used.
[0132] In some respects, a hybrid nuclease molecule includes a mutant Fc domain. In some respects, a hybrid nuclease molecule includes a mutant IgG1 Fc domain. In some aspects, a mutant Fc domain comprises one or more mutations in the joint, CH2 and / or CH3 domains. In some respects, a mutant Fc domain includes a P238S mutation. In some respects, a mutant Fc domain includes a P331S mutation. In some respects, a mutant Fc domain includes a P238S mutation and a P331S mutation. In some respects, a mutant Fc domain comprises P238S and / or P331S, and can include mutations in one or more of the three cysteine joints. In some respects, a mutant Fc domain comprises P238S and / or P331S, and / or one or more mutations in the three cysteine joints. In some respects, a mutant Fc domain comprises P238S and / or P331S, and / or mutations in one cysteine joint for SCC or in the three SSS cysteine joints. In some respects, a mutant Fc domain includes P238S and P331S and mutations in at least one of the three cysteine joints. In some respects, a mutant Fc domain comprises P238s and P331S and SSS. In some respects, a mutant Fc domain includes P238S and SCC or SSS. In some respects, a mutant Fc domain includes P331S and SCC or SSS. In some respects, a mutant Fc domain includes P331S and SCC or SSS. In some respects, a mutant Fc domain includes mutations in one or more of the three cysteine joints. In some respects, a mutant Fc domain includes mutations in one of the three cysteine joints for SCC. In some respects, a mutant Fc domain includes SCC. In some respects, a mutant Fc domain includes mutations in the three cysteine joints for SSS. In some respects, a mutant domain includes SSS. In some respects, a nucleic acid sequence encoding a mutant Fc domain is shown in SEQ ID NOS: 59, 71, 73, 75, 87, or 89. In some respects, a mutant Fc domain is shown in SEQ ID NOS: 60, 72.74, 76, 88, or 90. In some respects, a nucleic acid sequence encoding a hybrid nuclease molecule is shown in SEQ ID NOS: 61, 63, 65, 67.69, 77, 79, 81, 83, 85, 91, 93, 95 or 97. In some respects, a hybrid nuclease molecule is as shown in SEQ ID NOS: 62, 64, 66, 68, 70, 78, 80, 82, 84, 86 , 92, 96, or 98.
[0133] A variety of gene sequences from the Fc domain (for example, gene sequences from the human constant region) are available in the form of publicly accessible deposits. Domains of the constant region comprising a sequence of the Fc domain can be selected having a particular effector function (or loss of a particular effector function) or with a particular modification to reduce immunogenicity. Many antibody sequences and antibody coding genes have been published and appropriate Fc domain sequences (e.g., hinge, in the CH2, and / or CH3 sequences, or portions thereof) can be derived from these sequences using techniques recognized in the art. The genetic material obtained using any of the methods mentioned above can then be altered or synthesized to obtain polypeptides of the present invention. It would also be appreciated that the scope of this invention encompasses alleles, variants and mutations of the DNA sequences of the constant region.
[0134] Fc domain sequences can be cloned, for example, using the polymerase chain reaction and primers that are selected to amplify the domain of interest. To clone an Fc domain sequence from an antibody, mRNa can be isolated from the hybridoma, spleen, or lymphatic cells, reverse transcription within DNA, and PCR amplified antibody genes. PCR amplification methods are described in detail in U.S. Patent Nos .: US 4,683,195; US 4,683,202; US 4,800,159; US 4,965,188; and in, for example, “PCR Protocols: A Guide to Methods and Applications” (“PCR Protocols: A Guide to Methods and Applications”), Innis et al., Eds., Academic Press, San Diego, California (1999) ; Ho et al., 1989. "Gene" 77:51; Horton et al., 1993. ("Methods Enzymol", 217: 270). PCR can be initiated by primers from the consensus constant region or by more specific primers based on DNA and published light chain and heavy chain amino acid sequences. As discussed above, PCR can also be used to isolate the DNA clones encoding the antibody light chains and steps. In this case, libraries can be classified by consensus primers or larger homologous probes, such as probes from the mouse constant region. The numerous sets of primers suitable for the amplification of antibody genes are known in the art (for example, 5 'primers based on the N-terminal sequence of the purified antibodies (Benhar and Pastan. 1994. “Proteín Engineering”, 7: 1509 ); rapid amplification of the ends of the cDNA (Ruiberti, F. et al., 1994; “J. Immunol. Methods”, 173: 33); leading antibody sequences (Larrick et al., 1989, “Biochem. Biophys. Res Commun. ”, 160: 1250). The cloning of the antibody sequences is further described in Newman et al., US patent 5,658,570, filed January 25, 1995, which is incorporated by reference here.
[0135] The hybrid nuclease molecules of the invention can comprise one or more Fc domains (for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more Fc domains). In one embodiment, the Fc domains can be of different types. In one embodiment, at least one Fc domain present in the hybrid nuclease molecule comprises a hinge domain or portion thereof. In another embodiment, the hybrid nuclease molecule of the invention comprises at least one Fc domain that comprises at least one CH2 domain or portion thereof. In another embodiment, the hybrid nuclease molecule of the invention comprises at least one Fc domain that comprises at least one CH3 domain or portion thereof. In another embodiment, the hybrid nuclease molecule of the invention comprises at least one Fc domain that comprises at least one CH4 domain or portion thereof. In another embodiment, the hybrid nuclease molecule of the invention comprises at least one Fc domain that comprises at least one hinge domain or portion thereof and at least one CH2 domain or portion thereof (for example, in the CH2-joint orientation) . In another embodiment, the hybrid nuclease molecule of the invention comprises at least one Fc domain that comprises at least one CH2 domain or portion thereof and at least one CH3 domain or portion thereof (for example, in the CH2-CH3 orientation). In another embodiment, the hybrid nuclease molecule of the invention comprises at least one Fc domain comprising at least one hinge domain or portion thereof, at least one CH2 domain or portion thereof, and at least one CH3 domain or portion thereof , for example, in the joint-CH2-CH3, joint-CH3-CH2, or CH2-CH3-joint orientation.
[0136] In certain embodiments, the hybrid nuclease molecule comprises at least one complete Fc region derived from one or more heavy chain immunoglobulins (e.g., an Fc domain including, hinge, CH2, and CH3 domains, although these needed to be derived of the same antibody). In another embodiment, the hybrid nuclease molecule comprises at least two complete Fc domains derived from one or more heavy chain immunoglobulin. In preferred embodiments, the complete Fc domain is derived from a human IgG immunoglobulin heavy chain (e.g., human IgG1).
[0137] In another embodiment, a hybrid nuclease molecule of the invention comprises at least one Fc domain comprising a complete CH3 domain. In another embodiment, a hybrid nuclease molecule of the invention comprises at least one Fc domain comprising a complete CH2 domain. In another embodiment, a hybrid nuclease molecule of the invention comprises at least one Fc domain comprising at least one CH3 domain, and at least one domain of a hinge region, and a CH2 domain. In another embodiment, a hybrid nuclease molecule of the invention comprises at least one Fc domain comprising a joint and a CH3 domain. In another embodiment, a hybrid nuclease molecule of the invention comprises at least one Fc domain comprising a joint, a CH2 domain, and a CH3 domain. In a preferred embodiment, the Fc domain is derived from a human IgG immunoglobulin heavy chain (e.g., human IgG1).
[0138] Domains of the constant region or portions thereof constituting an Fc domain of a hybrid nuclease molecule of the invention can be derived from different immunoglobulin molecules. For example, a polypeptide of the invention can comprise a CH2 domain or portion thereof derived from an IgG1 molecule and a CH3 region or portion thereof derived from an IgG3 molecule. In another example, a hybrid nuclease molecule may comprise an Fc domain comprising an articulation domain, in part, of an IgG1 molecule and, in part, of an IgG3 molecule. As depicted here, it should be understood by one skilled in the art that an Fc domain can be altered so that it varies in the amino acid sequence of a naturally occurring antibody molecule.
[0139] In another embodiment, a hybrid nuclease molecule of the invention comprises one or more truncated Fc domains which are nonetheless sufficient to confer the Fc receptor (FcR) binding properties to the Fc region. Thus, an Fc domain of a hybrid nuclease molecule of the invention can comprise or consist of an FcRn binding moiety. The FcRn binding moieties can be derived from heavy chains of any isotype, including IgG1, IgG2, IgG3 and IgG4. In one embodiment, an FcRn binding portion of a human isotype IgG1 antibody is used. In another embodiment, an FcRn binding portion of a human isotype IgG4 antibody is used.
[0140] In one embodiment, a hybrid nuclease molecule of the invention loses one or more domains of the constant region of a complete Fc region, that is, they are partially or entirely deleted. In a certain embodiment, the hybrid nuclease molecules of the invention will lose an entire CH2 domain (ΔCH2 constructs). Those skilled in the art will appreciate that such constructs may be preferred due to the regulatory properties of the CH2 domain on the catabolic rate of the antibody. In certain embodiments, the hybrid nuclease molecules of the invention comprise deleted Fc regions from the CH2 domain derived from a vector (for example, from IDEC Pharmaceuticals, San Diego) encoding a domain of the human IgG1 constant region (see, for example, WO 02 / 060955 A2 and WO 02/096948 A2). This example of a vector is constructed to exclude the CH2 domain and provide a synthetic vector expressing an IgG1 constant region deleted from the domain. It should be noted that these examples of constructs are preferably constructed to fuse the connection of the CH3 domain directly into an articulation region of the respective Fc domain.
[0141] In other constructs, it may be desirable to provide a spacer peptide between one or more constituents of the Fc domain. For example, the spacer peptide can be placed between a hinge region and a CH2 domain and / or between a CH2 domain and a CH3 domain. For example, compatible constructs can be expressed where the CH2 domain has been deleted and the remaining CH3 domain (synthetic or non-synthetic) is linked to the articulation region with 1-20, 1-10 or 1-5 spacer amino acid peptides. Said spacer peptide can be added, for example, to ensure that regulatory elements of the constant region domain remain free and accessible or that the hinge region remains flexible. Preferably, any binding peptide compatible with the present invention will be relatively non-immunogenic and will not properly prevent Fc folding. Changes to the Fc amino acids:
[0142] In certain embodiments, an Fc domain employed in a hybrid nuclease molecule of the invention is altered or modified, for example, by mutation in the amino acid (for example, addition, deletion, or substitution). As used herein, the term "Fc domain variant" refers to an Fc domain having at least one amino acid modification, such as an amino acid substitution, when compared to the wild-type Fc from which the Fc domain is derived. For example, where the Fc domain is derived from a human IgG1 antibody, a variant comprises at least one amino acid mutation (e.g., substitution) when compared to a wild-type allele at the corresponding position in the human IgG1 Fc region.
[0143] The amino acid substitution of an Fc variant can be located at a position within the Fc domain referred to as corresponding to the portion number of that residue that would be given in an Fc region in an antibody.
[0144] In one embodiment, the Fc variant comprises a substitution at an amino acid position located in a hinge domain or portion thereof. In another embodiment, the Fc variant comprises a substitution at an amino acid position located in a CH2 domain or portion thereof. In another embodiment, the Fc variant comprises a substitution at an amino acid position located in a CH3 domain or portion thereof. In another embodiment, the Fc variant comprises a substitution at an amino acid position located in a CH4 domain or portion thereof.
[0145] In a given embodiment, the hybrid nuclease molecules of the invention comprise an Fc variant comprising more than one amino acid substitution. The hybrid nuclease molecules of the invention can comprise, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid substitutions. Preferably, the amino acid substitutions are spatially positioned one another over a range of at least 1 amino acid position or more, for example, at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid positions or more. More preferably, the constructed amino acids are spatially positioned apart from each other over a range of at least 5, 10, 15, 20 or 25 amino acid positions or more.
[0146] In certain embodiments, the Fc variant confers an improvement in at least one effector function transmitted by an Fc domain comprising said allele-wild Fc domain (for example, an improvement in the ability of the Fc domain to bind to Fc receptors (for example, example, FcYRI, FcyRII, or FcylII) or complementary proteins (for example, C1q), or to trigger antibody-dependent cytotoxicity (ADCC), phagocytosis, or complement-dependent cytotoxicity (CDCC). provides a constructed cysteine residue.
[0147] In some respects, an Fc domain includes changes in the regions between amino acids 234-238, including the LLGGP sequence at the beginning of the CH2 domain. In some aspects, an Fc variant alters the Fc-mediated effector function, particularly ADCC, and / or decreases the avidity of binding to the Fc receptors. In some respects, the sequence changes close to the CH2-CH3 junction, at positions such as K322 or P331 it can eliminate complement-mediated cytotoxicity and / or change the avidity of FcR binding. In some respects, an Fc domain incorporates changes in the P238 and P331 residues, for example, change in the wild allele prolines in these positions to the serine. In some respects, changes in the joint region in one or more of the three cysteine joints, to encode CCC, SCC, SSC, SCS, or SSS in these residues can also affect the FcR bond and molecular homogeneity, for example, through elimination of unpaired cysteines that can destabilize the folded protein.
[0148] The hybrid nuclease molecules of the invention may employ Fc variants recognized in the art that are known to impart an improvement in effector function and / or FcR binding. Specifically, a hybrid nuclease molecule of the invention can include, for example, a change (for example, a substitution) in one or more of the amino acid positions described in the international publications of PCT Nos: WO 88/07089 A1, WO 96/14339 A1, WO 98/05787 A1, WO 98/23289 A1, WO 99/51642 A1, WO 99 / 58572A1, WO 00/09560 A2, WO 00/32767 A1, WO 00/42072 A2, WO 02/44215 A2, WO 02/060919 A2, WO 03/074569 A2, WO 04/016750 A2, WO 04/029207 A2, WO 04/035752 A2, WO 04/063351 A2, WO 04/074455 A2, WO 04/099249 A2; WO 05/040217 A2; WO 04/044859, WO 05/070963 A1, WO 05/077981 A2; WO 05/092925 A2; WO 05/123780 A2; WO 06/019447 A1; WO 06/047350 A2 and WO 06/085967 A2; US Patent Publications Nos: US 2007/0231329, US 2007/0231329, US 2007/0237765, US 2007/0237766, US 2007/0237767, US 2007/0243188, US 2007/0248603, US 2007/02868559, US 2008 / 0057056; or US Patent Nos .: US 5,648,260; US 5,739,277; US 5,834,250; US 5,869,046; US 6,096,871; US 6,121,022; US 6,194,551; US 6,242,195; US 6,277,375; US 6,528,624; US 6,538,124; US 6,737,056; US 6,821,505; US 6,998,253; US 7,083,784; and US 7,317,091, each of which is incorporated herein by reference. In one embodiment, the specific change (for example, the specific substitution of one or more amino acids described in the art) can be done at one or more of the described amino acid positions. In another embodiment, a different change in one or more of the amino acid positions described (for example, different substitution of one or more amino acid positions described in the art) can be made.
[0149] Other amino acid mutations in the Fc domain are contemplated to reduce binding to the Fc gamma receptor and Fc gamma receptor subtypes. For example, mutations at positions 238, 239, 249, 252, 254, 255, 256, 258, 265, 267, 268, 269, 270, 272, 279, 280, 283, 285, 298, 289, 290, 292, 293, 294, 295, 296, 298, 301, 303, 305, 307, 312, 315, 322, 324, 327, 329, 330, 331, 333, 334, 335, 337, 338, 340, 356, 360, 373, 376, 378, 379, 382, 388, 389, 398, 414, 416, 419, 430, 434, 435, 437, 438, or 439 of the Fc region can alter the connection as described in U.S. Patent No. 6,737,056, granted on May 18, 2004, incorporated herein by reference in its entirety. This patent reported that the change of Pro331 in IgG3 to Ser resulted in six times less affinity when compared to unaltered IgG3, indicating the involvement of Pro331 in the R1 binding of the Fc gamma. In addition, amino acid modifications at positions 234, 235, 236, and 237, 297, 318, 320 and 322 are described as potentially altering the binding affinity receptor in U.S. Patent 5,624,821, issued April 29, 1997, and incorporated herein by reference in its entirety.
[0150] Additional mutations contemplated for use include, for example, those described in patent publication No. 2006/0235208, published on October 19, 2006 and incorporated herein by reference in their entirety. This publication describes Fc variants that exhibit reduced binding to gamma Fc receptors, reduced antibody-dependent cell-mediated cytotoxicity, or reduced complement-dependent cytotoxicity, which comprises at least one modification of the amino acid in the Fc region, including 232G, 234G, 234H, 235D, 235G, 235H, 236I, 236N, 236P, 236R, 237K, 237L, 237N, 237P, 238K, 239R, 265G, 267R, 269R, 270H, 297S, 299A, 299I, 299V, 325A, 325L, 327R, 328R, 329K, 330I, 330L, 330N, 330P, 330R, and 331L (numbering according to EU index), as well as double mutants 236R / 237K, 236R / 325L, 236R / 328R, 237K / 325L, 237K / 328R, 325L / 328R, 235G / 236R, 267R / 269R, 234G / 235G, 236R / 237K / 325L, 236R / 325L / 328R, 235G / 236R / 237K, and 237K / 325L / 328r. Other mutations contemplated for use as described in this publication include 227G, 234D, 234E, 234G, 234I, 234Y, 235D, 235I, 235S, 236S, 239D, 246H, 255Y, 258H, 260H, 264I, 267D, 267E, 268D, 268E, 272H, 272I, 272R, 281D, 282G, 283H, 284E, 293R, 295E, 304T, 324G, 324I, 327D, 327A, 328A, 328D, 328E, 328F, 328I, 328M, 328N, 328Q, 328T, 328V, 328Y, 330I, 330L, 330Y, 332D, 332E, 335D, an insertion of G between positions 235 and 236, an insertion of A between positions 235 and 236, an insertion of S between positions 235 and 236, an insertion and T between positions 235 and 236, an insertion of N between positions 235 and 236, an insertion of D between positions 235 and 236, an insertion of V between positions 235 and 236, an insertion of L between positions 235 and 236, an insertion of L of G between positions 235 and 236, an insertion of A between positions 235 and 236, an insertion of S between positions 235 and 236, an insertion of T between positions 235 and 236, an insertion of N between positions 235 and 236, an insertion of D between positions 235 and 236, an insertion of V between positions 235 and 236, an insertion of L between positions 235 and 236, an insertion of G between positions 297 and 298, an insertion of A between positions 297 and 298, an insertion of S between positions 297 and 298, an insertion of D between positions 297 and 298, an insertion of G between positions 326 and 327, an insertion of A between positions 326 and 327, an insertion of T between positions 326 and 327, an insertion of D between positions 326 and 327, and an insertion of E between positions 326 and 327 (the numbering is according to the EU index). In addition, the mutations described in the publication of U.S. Patent Application No. US 2006/0235208 include 227G / 332E, 234D / 332E, 234E / 332E, 234Y / 332E, 234I / 332E, 234G / 332E, 235I / 332E, 235S / 332E, 235D / 332E, 235E / 332E, 236S / 332E, 236A / 332E, 236S / 332D, 236A / 332D, 239D / 268E, 246H / 332E, 255Y / 332E, 258H / 332E, 260H / 332E, 264I / 332E, 264I / 332E, 264I / 332E, 264I / 332E , 267E / 332E, 267D / 332E, 268D / 332D, 268E / 332D, 268E / 332E, 268D / 332E, 268E / 330Y, 268D / 330Y, 272R / 332E, 272H / 332E, 283H / 332E, 284E / 332E, 293R / 332E / 332E, 295E / 332E, 304T / 332E, 324I / 332E, 324G / 332E, 324I / 332D, 324G / 332D, 327D / 332E, 328A / 332E, 328T / 332E, 328V / 332E, 328I / 332E, 328F / 332E, 328F / 332E , 328Y / 332E, 328M / 332E, 328D / 332E, 328E / 332E, 328N / 332E, 328Q / 332E, 328A / 332D, 328T / 332D, 328V / 332D, 328I / 332D, 328F / 332D, 328Y / 332D, 328Y / 332D, 328Y / 332D, 328Y / 332D, 328Y / 332D, 328Y / 332 / 332D, 328D / 332D, 328E / 332D, 328N / 332D, 328Q / 332D, 330L / 332E, 330Y / 332E, 330I / 332E, 332D / 330Y, 335D / 332E, 239D / 332E, 239D / 332E / 330Y, 239D / 332E / 330L, 239D / 332E / 330I, 239D / 332E / 268E, 239D / 332E / 268D, 239D / 332E / 327D, 239D / 332E / 284E, 239D / 268E / 330Y, 239D / 33 2E / 268E / 330Y, 239D / 332E / 327A, 239D / 332E / 268E / 327A, 239D / 332E / 330Y / 327A, 332E / 330Y / 268 E / 327A, 239D / 332E / 268E / 330Y / 327A, Insert G> 297-298 / 332E, Insert A> 297-298 / 332E, Insert S> 297-298 / 332E, Insert D> 297-298 / 332E, Insert G> 326-327 / 332E, Insert A> 326- 327 / 332E , Insert T> 326-327 / 332E, Insert D> 326-327 / 332E, Insert E> 326-327 / 332E, Insert G> 235-236 / 332E, Insert A> 235-236 / 332E, Insert S> 235 -236 / 332E, Insert T> 235- 236 / 332E, Insert N> 235-236 / 332E, Insert D> 235-236 / 332E, Insert V> 235-236 / 332E, Insert L> 235-236 / 332E, Insert G> 235-236 / 332D, Insert A> 235-236 / 332D, Insert S> 235-236 / 332D, Insert T> 235-236 / 332D, Insert N> 235-236 / 332D, Insert D> 235- 236 / 332D, Insert V> 235-236 / 332D, and Insert L> 235-236 / 332D (numbering according to the EU index) are contemplated for use. The mutant L234A / L235A is described, for example, in the publication of US patent application No. 2003/0108548, published on June 12, 2003 and incorporated by reference in its entirety. In the embodiments, the modifications are included both individually and in combination.
[0151] In certain embodiments, a hybrid nuclease molecule of the invention comprises an amino acid substitution for an Fc domain that alters the effector functions independent of the antibody antigen, in particular the antibody half-life circulation. Said hybrid nuclease molecules show both increased and decreased binding to the FcRn when compared to the hybrid nuclease molecules by losing these substitutions and, therefore, having an increased or decreased half-life in the serum, respectively. Fc variants with improved RcRn affinity are anticipated to have longer serum half-lives, and said smolecules have useful applications in mammalian treatment methods when the longer half-life of the administered polypeptide is desired, for example, to treat a disease or chronic disorder. In contrast, Fc variants with decreased FcRn binding affinity are expected to have shorter half-lives, and such molecules are also useful, for example, for administration to a mammal, where a shorter circulation time may be advantageous, for example. example, for an in vivo diagnostic image or in situations where the starting polypeptide has toxic side effects when present in the circulation for prolonged periods. Fc variants with decreased FcRn binding affinity are also less desirable for crossing the placenta and thus are also useful in the treatment of diseases or disorders in pregnant women. In addition, other applications in which reduced FcRn binding affinity may be desired by including those applications in which the location of the brain, kidney, and / or liver is desired. In an exemplary embodiment, the hybrid nuclease molecules of the invention exhibit reduced transport through the kidney glomerulus epithelium from the vasculature. In another embodiment, the hybrid nucelase molecules of the invention show reduced transport across the blood brain barrier (BBB) from the brain, within the vascular space. In one embodiment, a hybrid nuclease molecule with altered FcRn binding comprises at least one Fc domain (for example, one or two Fc domains) having one or more amino acid substitutions within "the FcRn binding loop" of an Fc domain. Examples of amino acid substitutions, which have altered FcRn binding activity are described in PCT International Publication No. WO 2005/047327, which is incorporated herein by reference.
[0152] In other embodiments, a hybrid nuclease molecule of the invention comprises an Fc variant comprising an amino acid substitution that changes the polypeptide antigen-dependent effector functions, in particular, ADCC or complement activation, for example, when compared to the Fc region of the wild allele. In an exemplary embodiment, said nuclease molecules have the altered binding to an Fc gamma receptor (e.g., CD16). Said hybrid nuclease molecules show both increased and decreased binding to the FcR range when compared to allele-wild polypeptides and, therefore, measure improved or reduced effector function, respectively. Fc variants with improved affinity for FcYRs are anticipated to improve effector function, and said molecules have useful applications in methods for treating mammals where destruction of the target molecule is desired. In contrast, Fc variants with decreased FcyR binding affinity are expected to reduce effector function, and such molecules are also useful, for example, for treating conditions in which target cell destruction is undesired, for example, where cells Normal cells can express target molecules, or where chronic administration of the polypeptide can result in the activation of the unwanted immune system. In one embodiment, the polypeptide comprising an Fc has at least one effected function dependent on the altered antigen by selecting from the group consisting of opsonization, phagocytosis, complement-dependent cytotoxicity, antigen-dependent cell cytotoxicity (ADCC), or effector cell modulation when compared to a polypeptide comprising an allele-wild Fc region.
[0153] In one embodiment, the hybrid nucelase molecule has the altered bond for an FcyR activation (for example, FcyI, FcyIIa, or FcyRIIIa.). In another embodiment, the hybrid nuclease molecule has altered binding affinity for an FCYR inhibitor (for example, FcyRIIb). Exemplary amino acid substitutions whose altered FcR or complement binding activity are described in the publication of the international application WO 2005/063815, which is incorporated herein by reference in its entirety.
[0154] The hybrid nuclease molecule of the invention may comprise an amino acid substitution that alters the glycosylation of the hybrid nuclease molecule. For example, the Fc domain of the hybrid nuclease molecule can comprise an Fc domain having a mutation leading to reduced glycosylation (for example, N- or O- linked glycosylation) or it can comprise an altered glycoform of the allele-wild Fc domain (for example, example, a lower fucose or a fucose-free glycan). In another embodiment, the hybrid nuclease molecule has an amino acid substitution close to or within the glycosylation ("motif") portion, for example, an N-linked glycosylation portion that contains the NXT or NXS amino acid sequence. Exemplary amino acid substitutions that reduce or alter glycosylation are described in international application publication WO 2005/018572 and in US patent publication 2007/0111281, which are incorporated herein by reference.
[0155] In another embodiment, a hybrid nuclease molecule of the invention comprises at least one Fc domain having a constructed cysteine residue or analog thereof that is located on the surface exposed to the solvent. Preferably, the constructed cysteine residue or analog thereof does not interfere with an effector function conferred by Fc. More preferably, the change does not interfere with the ability of Fc to bind to Fc receptors (for example, FcYRI, FcYRII, or FcYRIII) or complement proteins (for example, CIq), or to trigger the immune effector function (for example, antibody-dependent cytotoxicity (ADCC), phagocytosis, or complement-dependent cytotoxicity (CDCC)). In a preferred embodiment, the hybrid nuclease molecules of the invention comprise an Fc domain comprising at least one free constructed cysteine residue or analog thereof that is substantially free of the disulfide bond with a second cysteine residue. Any of the constructed cysteine residues or analogues thereof, mentioned above, can subsequently be conjugated to a functional domain using techniques recognized in the prior art (for example, conjugated to a thiol-reactive hetero-bifunctional ligand).
[0156] In one embodiment, the hybrid nuclease molecule of the invention may comprise a genetically fused Fc domain having two or more of its constituent Fc domains independently selected from the Fc domains described herein. In one embodiment, the Fc domains are the same. In another embodiment, at least two of the Fc domains are different. For example, the Fc domains of the hybrid nuclease molecules of the invention comprise the same number of amino acid residues or they may differ in length by one or more amino acid residues (for example, about 5 amino acid residues (for example, 1 , 2, 3, 4 or 5 amino acid residues), about 10 residues, about 15 residues, about 20 residues, about 30 residues, about 40 residues, or about 50 residues). In yet another embodiment, the Fc domains of the hybrid nuclease molecules of the present invention can differ in the sequence of one or more amino acid positions. For example, at least two of the Fc domains can differ by about 5 amino acid positions (for example, 1, 2, 3, 4, or 5 amino acid positions), about 10 positions, about 15 positions, about 20 positions, about 30 positions, about 40 positions, or about 50 positions). Binding domains:
[0157] In some embodiments, a hybrid nuclease molecule includes a linker domain. In some embodiments, a hybrid nuclease molecule includes a plurality of linker domains. In some embodiments, the linker domain is a linker polypeptide. In certain aspects, it is desirable to employ a linker polypeptide to fuse one or more Fc domains to one or more nuclease domains to form a hybrid nuclease molecule.
[0158] In one embodiment, the binding polypeptide is synthetic. As used here, the term "synthetic" in connection with a binding polypeptide includes peptides (or polypeptides) that comprise an amino acid sequence (which may or may not be naturally occurring) that is linked in a linear sequence of amino acids to a sequence (which may or may not be naturally occurring) (for example, a sequence from the Fc domain) to which it is not naturally linked in nature. For example, the binding polypeptide may comprise non-naturally occurring polypeptides that are modified forms of naturally occurring polypeptides (for example, comprising a mutation, such as, addition, substitution or deletion) or that comprise a first amino acid sequence (which may or may not be naturally occurring). The polypeptide ligands of the invention can be employed, for example, to ensure that the Fc domains are juxtaposed to ensure proper folding and the formation of a functional Fc domain. Preferably, a binding polypeptide compatible with the present invention will be relatively non-immunogenic and will not inhibit and inhibit any non-covalent association between monomer subunits of a binding protein.
[0159] In certain embodiments, the hybrid nuclease molecules of the invention employ a binding polypeptide to link any two or more domains in the structure of a single polypeptide chain. In one embodiment, the two or more domains can be independently selected from any Fc domains or nuclease domains discussed here. For example, in certain embodiments, a binding polypeptide can be used to fuse identical Fc domains, thereby forming a homomeric Fc region. In other embodiments, a binding polypeptide can be used to fuse different Fc domains (for example, an allele-wild Fc domain and a variant of the Fc domain), thereby forming a heteromeric Fc region. In another embodiment, a binding polypeptide of the invention can be used to fuse the C-terminus of a first Fc domain (for example, a hinge domain or portion thereof, a CH2 domain or portion thereof, a complete CH3 domain or portion thereof, an FcRn binding portion, an FcYR binding portion, a complement binding portion, or portion thereof) to the N-terminus of a second Fc domain (e.g., a complete Fc domain).
[0160] In one embodiment, a binding polypeptide comprises a portion of an Fc domain. For example, in one embodiment, a binding polypeptide can comprise an immunoglobulin hinge domain of an IgG1, IgG2, IgG3, and / or IgG4 antibody. In another embodiment, a binding polypeptide can comprise a CH2 domain of an IgG1, IgG2, IgG3, and / or an IgG4 antibody. In other embodiments, a binding polypeptide can comprise a CH3 domain of an IgG1, IgG2, IgG3, and / or IgG4 antibody. Other portions of an immunoglobulin (e.g., human immunoglobulin) can be used as well. For example, a binding polypeptide can comprise a CH1 domain or portion thereof, a CL domain or portion thereof, a VH domain or portion thereof, or a VL domain or portion thereof. Said portions can be derived from any immunoglobulin, including, for example, an IgG1, IgG2, IgG3, and / or IgG4 antibody.
[0161] In examples of embodiments, a binding polypeptide can comprise at least a portion of an immunoglobulin hinge region. In one embodiment, a binding polypeptide comprises an upper hinge domain (for example, an upper IgG1, IgG2, IgG3, or an upper IgG4 hinge domain). In another embodiment, a binding polypeptide comprises a median binding domain (for example, an IgG2 median hinge domain, an IgG3, or an IgG4). In another embodiment, a binding polypeptide comprises a lower hinge domain (for example, an IgG1 lower hinge domain, an IgG2, an IgG3, or an IgG4).
[0162] In another embodiment, polypeptide ligands can be constructed to combine articulation elements derived from the same or different antibody isotypes. In one embodiment, the binding polypeptide comprises a chimeric hinge comprising at least a portion of an IgG1 hinge region and at least a portion of an IgG2 hinge region. In one embodiment, the binding polypeptide comprises a chimeric hinge comprising at least a portion of an IgG1 hinge region and at least a portion of an IgG3 hinge region. In another embodiment, a binding polypeptide comprises a chimeric hinge comprising at least a portion of an IgG1 hinge region and at least a portion of an IgG4 hinge region. In one embodiment, the binding polypeptide comprises a chimeric hinge comprising at least a portion of an IgG2 hinge region and at least a portion of an IgG3 hinge region. In one embodiment, the linker polypeptide comprises a chimeric hinge comprising at least a portion of an IgG2 hinge region and at least a portion of an IgG4 hinge region. In one embodiment, the binding polypeptide comprises a chimeric joint comprising at least a portion of an IgG1 hinge region, at least a portion of an IgG2 hinge region, and at least a portion of an IgG4 hinge region. In another embodiment, a binding polypeptide can comprise an upper IgG1 and an intermediate joint and a repeat portion of the single IgG3 median joint. In another embodiment, a binding polypeptide can comprise an IgG4 upper joint, an IgG1 median joint and an IgG2 lower joint.
[0163] In one embodiment, a binding polypeptide comprises or consists of a glyceride linker. As used herein, the term "glyceride ligand" refers to a peptide consisting of glycine and serine residues. An example of a glyc / ligand comprises an amino acid sequence of the formula (Gli4Ser) n, where n is a positive integer (for example, 1, 2, 3, 4 or 5). A preferred linker of gly / ser is (Gli4Ser) 4. Another preferred gli / ser ligand is (Gli4Ser) 3. Another preferred gli / ser linker is (Gli4Ser) 5. In certain embodiments, the glycerine ligand can be inserted between two other sequences of the polypeptide ligands (for example, any of the polypeptide binding sequences described here). In another embodiment, a glycerine ligand is attached to one or more ends of another peptide ligand sequence (for example, any of the polypeptide ligand sequences described here. In yet another embodiment two or more glyceride ligands ser are incorporated in series into a binding polypeptide.In one embodiment, a binding polypeptide of the invention comprises at least a portion of an upper hinge region (for example, derived from an IgG1, IgG2, IgG3, or IgG4 molecule) , at least a portion of a median hinge region (e.g., derived from an IgG1, IgG2, IgG3, or IgG4 molecule) and a series of amino acid residues gli / ser (e.g., a gli / ser ligand such as ( Gli4 Ser) n).
[0164] In another embodiment, a binding polypeptide of the present invention comprises an unnaturally occurring immunoglobulin hinge region domain, for example, the hinge region domain that is not found naturally in the polypeptide comprising the region domain of articulation and / or a domain of the articulation region that has been altered so that it differs in the amino acid sequence from a domain of the naturally occurring immunoglobulin articulation region. In one embodiment, mutations can be made for the domains of the hinge region to make a binding polypeptide of the invention. In one embodiment, a hinge polypeptide of the invention comprises a hinge domain that does not comprise a naturally occurring number of cysteines, that is, the linker polypeptide comprises both few cysteines and a greater number of cysteines than one hinge molecule. naturally occurring.
[0165] In another embodiment, a binding polypeptide of the invention comprises a biologically relevant peptide sequence or a sequence portion thereof. For example, a biologically relevant peptide sequence may include, but is not limited to, sequences derived from an anti-rejection peptide or anti-inflammatory peptide. Said anti-rejection or anti-inflammatory peptides can be selected from the group consisting of a cytokine inhibitory peptide, a cell adhesion inhibitory peptide, a thrombin inhibitory peptide, and a platelet inhibitory peptide. In a preferred embodiment, a binding polypeptide comprises a peptide sequence selected from the group consisting of an IL-1 inhibitor or antagonist peptide sequence, an erythropoietin (EPO) -mimetic peptide sequence, a thrombopoietin peptide sequence (TPO ) -mimetic, a mimetic G-CSF peptide sequence, a TNF-antagonist peptide sequence, an integrin-binding peptide sequence, a selectin antagonist peptide sequence, an anti-pathogenic peptide sequence, an intestinal peptide sequence vasoactive (VIP), a calmodulin antagonist peptide sequence, a breast cell antagonist, a SH3 antagonist peptide sequence, a urokinase receptor antagonist (UKR) peptide sequence, a somatostatin or cortistatin mimetic peptide sequence, and a sequence of macrophage cell and / or T cell inhibitory peptide. Examples of peptide sequences, any of which can be and employed as a binding polypeptide are described in U.S. Patent No. US 6,660,843, which is incorporated herein by reference.
[0166] It will be understood that the variant forms of these exemplary polypeptide ligands can be created by introducing one or more substitutions, additions or deletions within the nucleotide sequence encoding a binding polypeptide such that one or more substitutions, additions or deletions amino acids are introduced into the binding polypeptide. For example, mutations can be introduced by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis.
[0167] The polypeptide linkers of the present invention are at least one amino acid in length and can be of varying length. In one embodiment, a polypeptide linker of the invention is about 1 to about 50 amino acids in length. As used in this context, the term "about" indicates +/- two amino acid residues. Since the length of the linker must be a positive integer, the length of about 1 to about 50 amino acids in length means a length of about 1 to 48-52 amino acids in length. In another embodiment, a polypeptide linker of the invention is about 10-20 amino acids in length. In another embodiment, a polypeptide linker of the invention is about 15 to about 50 amino acids in length.
[0168] In another embodiment, a polypeptide linker of the present invention is about 20 to about 45 amino acids in length. In another embodiment, a polypeptide linker of the present invention is about 15 to about 25 amino acids in length. In another embodiment, a polypeptide linker of the invention is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 , 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, or more amino acids in length.
[0169] Polypeptide ligands can be introduced into the polypeptide sequences using techniques known in the art. Modifications can be confirmed through DNA sequence analysis. Plasmid DNA can be used to transform host cells for stable production of the produced polypeptides. Nuclease domains:
[0170] In certain respects, a hybrid nuclease molecule includes a nuclease domain. Consequently, the hybrid nuclease molecules of the invention typically comprise at least one nuclease domain and at least one Fc-binding domain. In certain aspects, a hybrid nuclease molecule includes a plurality of nuclease domains.
[0171] In some embodiments, a nuclease domain is substantially all or at least one enzymatically active fragment of a DNase. In some embodiments, DNase is a secreted DNase of type 1, preferably a human DNase such as a DNase 1. Examples of DNase 1 domains are represented in SEQ ID NOs: 48-53 and 102. An example of human DNase 1 it is described in UniProtKB, entry P24855 (SEQ ID NOs: 49 and 102). In some embodiments, DNase is a DNase 1 and / or an enzyme (DNase L) type DNase 1, 1-3. An example of a human Dnase 1 eenzyme 1-3 is described in UniProtKB, entry Q13609 (SEQ ID NOs: 57 and 103). In some embodiments, DNase is TREX1 (three exonuclease 1 repair primers). An example of human TREX1 is described in UniProtKB, entry Q9NSU2 (SEQ ID NO: 104). Preferably, human TREX1 is a truncated C-terminal human TREX1 that has lost intracellular nuclear target sequences, for example, a human TREX1 without the C-terminal 72 amino acids, as shown in SEQ ID NO; 105.
[0172] In some embodiments, a nuclease domain is substantially all or at least one enzymatically active fragment of an RNase. In one embodiment, RNase is an extracellular RNase or RNase A secretory of the RNase A superfamily, for example, RNase A, preferably a human pancreatic RNAse. An example of human RNase is described in UniProtKB, entry P07998 (SEQ ID NOs: 58 and 101).
[0173] In one embodiment, the nuclease domain is operably linked (for example, chemically conjugated or genetically fused (for example, either directly or via a polypeptide linker)) to an N-terminus of an Fc domain. In another embodiment, the nuclease domain is operably linked (for example, chemically conjugated or genetically fused (for example, either directly or via a polypeptide linker)) to a C-terminus of an Fc domain. In other embodiments, a nuclease domain is operably linked (for example, chemically conjugated or genetically fused (for example, either directly or via a peptide linker)) via an amino acid side chain from an Fc domain. In a given exemplary embodiment, the nuclease domain is fused to an Fc domain via a human immunoglobulin hinge domain or portion thereof.
[0174] In certain embodiments, the hybrid nuclease molecules of the present invention comprise two or more nuclease domains and at least one Fc domain. For example, the nuclease domains can be operably linked to both the N-terminus and the C-terminus of an Fc domain. In another exemplary embodiment, the nuclease domains can be operably linked to both C- and N-terminal ends of multiple Fc domains (e.g., two, three, four, five, or more Fc domains) that are linked together in series in the form of a sequential arrangement (“tandem”) of the Fc domains.
[0175] In other embodiments, two or more nuclease domains are linked together (for example, via a polypeptide linker) in series, and the sequential arrangement of the nuclease domains is operably linked (for example, chemically conjugated or genetically fused (for example, either directly or via a polypeptide linker)) for either the C-terminal or the N-terminal of an Fc domain or a sequential arrangement of the Fc domains. In other embodiments, the sequential arrangement of the nuclease domains is operably linked to both the C-terminal and the N-terminal of an Fc domain or a sequential arrangement of Fc domains.
[0176] In other embodiments, one or more nuclease domains can be inserted between two Fc domains. For example, one or more nuclease domains can form all or part of a peptide linker of a hybrid nuclease molecule of the invention.
[0177] The preferred hybrid nuclease molecules of the present invention comprise at least one nuclease domain (e.g., RNase or DNase), at least one binding domain, and at least one Fc domain.
[0178] In certain embodiments, the hybrid nuclease molecules of the invention have at least one nuclease domain specific for a target molecule that mediates a biological effect. In another embodiment, the attachment of the hybrid nuclease molecules of the invention to a target molecule (for example, DNA or RNA) results in the reduction or elimination of the target molecule, for example, from a cell, tissue, or circulation.
[0179] In certain embodiments, the hybrid nuclease molecules of the present invention can comprise two or more nuclease domains. In one embodiment, the nuclease domains are identical, for example, RNase and RNase, or TREX1 and TREX1. In another embodiment, the nuclease domains are different, for example, DNase and RNase.
[0180] In other embodiments, the hybrid nuclease molecules of the present invention can be arranged together or with other polypeptides to form binding proteins having two or more polypeptides ("multimers"), where at least one polypeptide of the multimer is a molecule of hybrid nuclease of the invention. Exemplary multimeric forms include dimeric, trimeric, tetrameric, and altered hexameric and gender-binding proteins. In one embodiment, the multimer polypeptides are the same (i.e., altered homomeric binding proteins, e.g., homodimers, homotetramers). In another embodiment, the multimer polypeptides are different (for example, heteromeric). Methods for preparing hybrid nuclease molecules
[0181] The hybrid nuclease molecules of this invention can be made predominantly in transformed host cells using recombinant DNA techniques. For this, a recombinant DNA molecule encoding the peptide is prepared. Methods for preparing said DNA molecules are well known in the art. For example, coding sequences for the peptides could be cut from the DNA using appropriate restriction enzymes. Alternatively, the DNA molecule could be synthesized using chemical synthesis techniques, such as the phosphoramidate method (“phosphoramidate”). A combination of these techniques can also be used.
[0182] The invention also includes a vector capable of expressing the peptides in an appropriate host. The vector comprises the DNA molecule that codes for the operably linked peptides for proper expression of the control sequences. The methods for affecting this operative link, both before and after the DNA molecule has been inserted into the vector, are well known. Expression control sequences include promoters, activators, enhancers, operators, ribosomal nuclease domains, initiation signals, termination signals, cover signals, polyadenylation signals, and other signals involved with transcription or translation control.
[0183] The resulting vector having the DNA molecule in it is used to transform a suitable host. This transformation can be carried out using methods well known in the art.
[0184] Any of a large number of available and well-known host cells that can be used in the practice of this invention. The selection of a particular host is dependent on a number of factors recognized by the technique. These include, for example, compatibility with the choice of the expression vector, toxicity of the peptides encoded by the DNA molecule, transformation rate, ease of recovery of the peptides, expression characteristics, biosafety and costs. A balance of these factors must be found with the understanding that not all hosts can be equally effective for the expression of a specific DNA sequence. Within this general guide, useful microbial hosts include bacteria (such as E. coli sp.), Yeast (such as Saccharomyces sp.), And other fungi, insects, plants, mammalian cells (including humans) in culture, or other hosts known in the art.
[0185] The transformed host is then cultivated and purified. Host cells can be cultured under conventional fermentation conditions so that the desired compounds are expressed. Said fermentation conditions are well known in the art. Finally, the peptides are purified from the culture using methods well known in the art.
[0186] The compounds can also be made using synthetic methods. For example, solid phase synthesis techniques can be used. Appropriate techniques are well known in the art and include those described in Merrifield (1973), “Chem. Polypeptides ”, pp. 335-61 (Katsoyannis and Panayotis eds.); Merrifield (1963), “J. Am. Chem. Soc. ”, 85: 2149; Davis et al. (1985), “Biochem. Intl. ”, 10: 394-414; Stewart and Young (1969), "Solid Phase Peptide Synthesis"; U.S. Pat. No .: 3,941,763; Finn et al. (1976), "The Proteins (3rd ed.)", 2: 105-253; and Erickson et al. (1976), "The Proteins (3rd ed.)", 2: 257-527. Solid phase synthesis is the preferred technique for preparing individual peptides since this is a cost effective method for preparing small peptides. Compounds that contain derived peptides or that contain non-peptide groups can be synthesized by well-known organic chemistry techniques.
[0187] Other methods for expression / synthesis of molecules are generally known in the art to those skilled in the art. Pharmaceutical compositions and therapeutic methods of use
[0188] In certain embodiments, a hybrid nuclease molecule is administered alone. In a given embodiment, a hybrid nuclease molecule is administered prior to the administration of at least one other therapeutic agent. In certain embodiments, a hybrid nuclease molecule is administered concomitantly with the administration of at least one other therapeutic agent. In certain embodiments, a hybrid nuclease molecule is administered subsequently to the administration of at least one other therapeutic agent. In other embodiments, a nuclease molecule is administered prior to the administration of at least one other therapeutic agent. As will be appreciated by a person skilled in the art, in some embodiments, the hybrid nuclease molecule is combined with the other agent / compound. In some embodiments, the hybrid nuclease molecule and another agent are administered concomitantly. In some embodiments, the hybrid nuclease molecule and another agent are not administered simultaneously, with the hybrid nuclease molecule being administered before or after the agent is administered. In some embodiments, the individual receives both the hybrid nuclease molecule and or another agent during the same prevention period, the occurrence of a disorder, and / or a treatment period.
[0189] The pharmaceutical compositions of the invention can be administered in combination therapies, i.e., combined with other agents. In certain embodiments, a combined therapy comprises the nuclease molecule, in combination with at least one other agent. Agents include, but are not limited to, chemical compositions prepared synthetically in vitro, antibodies, antigen-binding regions, and combinations and conjugates thereof. In certain embodiments, an agent can act as an agonist, antagonist, alloteric modulator, or toxin.
[0190] In certain embodiments, the invention provides pharmaceutical compositions comprising a hybrid nuclease molecule together with a pharmaceutically acceptable diluent, a vehicle, solubilizer, emulsifier, preservative and / or adjuvant.
[0191] In certain embodiments, the invention provides pharmaceutical compositions comprising a hybrid nuclease molecule and a therapeutically effective amount of at least one additional therapeutic agent, together with a pharmaceutically acceptable diluent, vehicle, solubilizer, emulsifier, preservative and / or adjuvant.
[0192] In certain embodiments, the appropriate formulation materials are preferably non-toxic to the recipients at the dosages and concentrations employed. In some embodiments, the formulation material (s) is (are) for sc and / or IV administration In certain embodiments, the pharmaceutical composition may contain the formulation materials for modification, maintenance or preservation, for example, of the pH, osmolarity, viscosity, clarity, color, isotonicity, odor, sterility, stability, dissolution or release rate, adsorption or penetration of the composition. In certain embodiments, appropriate formulation materials include, but are not limited to, amino acids (such as, glycine, glutamine, asparagine, arginine or lysine); antimicrobials; antioxidants (such as ascorbic acid, sodium sulfite or sodium hydrogen sulfite); buffers (such as borate, bicarbonate, Tris-HCl, citrates, phosphates or other organic acids); swelling agents, (such as mannitol or glycine); chelating agents (such as ethylenediamine tetraacetic acid (EDTA)); complexing agents (such as caffeine, poly (vinyl pyrrolidones), beta-cyclodextrin or hydroxypropyl-beta-cyclodextrin); filling material, monosaccharides; disaccharides; and other carbohydrates (such as, glucose, mannose or dextrins); proteins (such as serum albumin, gelatin or immunoglobulins); coloring, flavoring and diluting agents, emulsifying agents; hydrophilic polymers (such as poly (vinyl pyrrolidones)); low molecular weight polypeptide; salt-forming counterions (such as sodium), preservatives (such as benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid or hydrogen peroxide); solvents (such as glycerin, propylene glycol or polyethylene glycol); sugar alcohols (such as mannitol or sorbitol); suspending agents, surfactants or wetting agents (such as pluronic, PEG, sorbitan esters, polysorbate, such as polysorbate 20, polysorbate 80, tripton, tromethamine, lecithin, cholesterol, tiloxapal); stability-improving agents (such as sucrose and sorbitol); tonicity-enhancing agents (such as alkali metal halides, preferably sodium chloride or potassium chloride, sorbitol mannitol); delivery vehicles, diluents, excipients and / or pharmaceutical adjuvants. (“Remington’s Pharmaceutical Sciences”, 18th Edition, A. R. German, ed., Mack Publishing Company (1995)). In some embodiments, the formulation comprises PBS; 20 mM NaOAC, pH 5.2, 50 mM NaCl; and / or 10 mM NAOAC, pH 5.2; 9% sucrose.
[0193] In certain embodiments, a hybrid nuclease molecule and / or a therapeutic molecule is attached to a half-life extending vehicle known in the art. Such vehicles include, but are not limited to, polyethylene glycol, glycogen (e.g., glycosylation of the hybrid nuclease molecule), and dextran. Such vehicles are described, for example, in US patent application No .: US 09 / 428,082, currently US patent 6,660,843 and international PCT patent application No .: WO 99/25044, which have been incorporated by reference here for any purpose.
[0194] In certain embodiments, the optimal pharmaceutical composition will be determined by a person skilled in the art depending on, for example, the intended route of administration, release format and desired dosage. See, for example, Remington’s Pharmaceutical Sciences, supra. In certain embodiments, said compositions can influence the physical state, stability, rate of in vivo release, and rate of in vivo release of the antibodies of the invention.
[0195] In certain embodiments, the primary vehicle or carrier in a pharmaceutical composition can be both aqueous and non-aqueous in nature. For example, in certain embodiments, an appropriate vehicle or carrier may be water for injection, physiological saline or an artificial cerebrospinal fluid, possibly supplemented with other materials common in compositions for parenteral administration. In some embodiments, the saline comprises saline buffered with isotonic phosphate. In certain embodiments, neutral buffered saline or saline mixed with serum albumin are additional exemplary vehicles. In certain embodiments, the pharmaceutical compositions comprise Tris buffer with a pH of about 7.0-8.5, or acetate buffer with a pH of about 4.0-5.5, which may also include sorbitol or a suitable substitute . In certain embodiments, a composition comprising a hybrid nuclease molecule, with or without at least one additional therapeutic agent, can be prepared for storage by mixing the selected composition having the desired degree of purity with optional formulation agents (Remington's Pharmaceutical Sciences, supra), in the form of a lyophilized cake or an aqueous solution. In addition, in certain embodiments, a composition comprising a hybrid nuclease molecule, with or without at least one additional therapeutic agent, can be formulated as a lyophilizate using appropriate excipients such as sucrose.
[0196] In certain embodiments, the pharmaceutical composition can be selected for parenteral release. In certain embodiments, the compositions can be selected for inhalation or for delivery through the digestive tract, such as orally. The preparation of said pharmaceutically acceptable compositions is within the skill of a person skilled in the art.
[0197] In certain embodiments, the components of the formulation are present in concentrations that are acceptable to the administration sites. In certain embodiments, buffers are used to maintain the composition at a physiological pH or at a slightly lower pH, typically within a pH range of about 5 to about 8.
[0198] In certain embodiments, when parenteral administration is contemplated, a therapeutic composition may be in the form of a pyrogen-free parenterally acceptable aqueous solution, comprising a hybrid nuclease molecule, with or without additional therapeutic agents, in a pharmaceutically acceptable carrier . In certain embodiments, a vehicle for parenteral injection is sterile distilled water in which a hybrid nuclease molecule, with or without at least one additional therapeutic agent, is formulated as a sterile, isotonic solution, suitably preserved. In certain embodiments, the preparation can involve formulating the desired molecule with an agent, such as injectable microspheres, bioerodible particles, polymeric compounds (such as polylactic acid or polyglycolic acid), beads or liposomes, which can provide sustained controlled release of the product which can then be released via a deposited injection. In certain embodiments, hyaluronic acid can also be used, and can have the effect of promoting sustained duration in the circulation. In certain embodiments, implantable drug delivery devices can be used to introduce the desired molecule.
[0199] In certain embodiments, a pharmaceutical composition can be formulated for inhalation. In certain embodiments, a hybrid nuclease molecule, with or without at least one additional therapeutic agent, can be formulated as a dry powder for inhalation. In certain embodiments, an inhalation solution comprising a hybrid nuclease molecule, with or without at least one additional therapeutic agent, can be formulated with a propellant for aerosol delivery. In certain embodiments, the solutions can be nebulized. Pulmonary administration is further described in PCT patent application No. PCT / US 94/001875, which describes the pulmonary release of chemically modified proteins.
[0200] In certain embodiments, it is contemplated that formulations can be administered orally. In certain embodiments, a hybrid nuclease molecule, with or without at least one additional therapeutic agent, which is administered in this form can be formulated with or without those vehicles conventionally used in the composition of solid dosage forms, such as tablets and capsules. In certain embodiments, a capsule can be designed to release the active portion of the formulation at the point of the gastrointestinal tract when bioavailability is maximized and pre-systemic degradation is minimized. In certain embodiments, at least one additional agent can be included to facilitate the absorption of a hybrid nuclease molecule and / or any additional therapeutic agent. In certain embodiments, diluents, flavorings, low melting point waxes, vegetable oils, lubricants, suspending agents, tablet disintegrating agents, and binders can also be employed.
[0201] In certain embodiments, a pharmaceutical composition can involve an effective amount of a hybrid nuclease molecule, with or without at least one additional therapeutic agent, in a mixture with non-toxic excipients that are suitable for the manufacture of tablets. In certain embodiments, by dissolving the tablets in sterile water, or another appropriate vehicle, the solutions can be prepared in the form of a single dose. In certain embodiments, suitable excipients include, but are not limited to, inert diluents, such as calcium carbonate, sodium carbonate, or bicarbonate, lactose, or calcium phosphate; or binding agents, such as, starch, gelatin, or acacia; or lubricating agents, such as magnesium stearate, stearic acid, or talc.
[0202] Additional pharmaceutical compositions will be apparent to those skilled in the art, including formulations involving a hybrid nuclease molecule, with or without at least one additional therapeutic agent, in sustained release formulations or controlled release formulations. In certain embodiments, techniques for formulating a variety of other sustained or controlled release media, such as liposome vehicles, bioerodible microparticles, or porous beads and deposited injections, are also known to those of skill in the art. See, for example, international patent application No. PCT / US93 / 00829, which describes the controlled release of porous polymeric microparticles for the release of pharmaceutical compositions. In certain embodiments, sustained release preparations may include semipermeable polymer matrices in the form of articles formed, for example, films, or microcapsules. Sustained-release matrices can include polyesters, hydrogels, polylactides (U.S. Patent No .: US 3,773,919 and EP 058,481), copolymers of L-glutamic acid and ethyl-L-glutamate range (Sidman et al., “Biopolymers” , 22: 547-556 (1983)), poly (2-hydroxyethyl-methacrylate) (Langer et al., "J. Biomed. Mater. Res.", 15: 167-277 (1981) and Langer, "Chem. Tech. ”, 12: 98-105 (1982)), ethylene vinyl acetate (Langer et al., Supra) or poly-D (-) - 3-hydroxybutyric acid (EP 133,988). In certain embodiments, sustained release compositions can also include liposomes, which can be prepared by any of a number of methods known in the art. See, for example, Eppstein et al., “Proc. Natl. Acad. Sci. ”, USA, 82: 3688-3692 (1985); EP 036,676; EP 088,046 and EP 143,949.
[0203] The pharmaceutical composition to be used for ethically sterile in vivo administration. In certain embodiments, this can be accompanied by filtration through sterile filter membranes. In certain embodiments, where the composition is lyophilized, sterilization using this method can be conducted either before or after lyophilization and reconstitution. In certain embodiments, the composition for parenteral administration can be stored in lyophilized form or in a solution. In certain embodiments, parenteral compositions are generally placed inside a container having a sterile access port, for example, an intravenous solution pouch or vial having a pierceable interruption through a hypodermic injection needle.
[0204] In certain embodiments, once the pharmaceutical composition has been formulated, it can be stored in sterile vials as a solution, suspension, gel, emulsion, solid, or as a dehydrated or lyophilized powder. In certain embodiments, such formulations can be stored either in a ready-to-use form or in a form (for example, lyophilized) that is reconstituted prior to administration.
[0205] In certain embodiments, kits are provided to produce a single dose administration unit. In certain embodiments, the kit can contain both a first container having a dry protein and a second container having an aqueous formulation. In certain embodiments, a kit containing single syringes and pre-filled multiple-chamber syringes (for example, liquid syringes and syringes) is included.
[0206] In certain embodiments, the effective amount of a pharmaceutical composition comprising a hybrid nuclease molecule, with or without at least one additional therapeutic agent, to be employed therapeutically will depend, for example, on the therapeutic context and objectives. A person skilled in the art will appreciate that the appropriate dosage levels for treatment, according to certain embodiments, will thus vary depending, in part, on the molecule released, on the indication for which a hybrid nuclease molecule, with or without at least an additional therapeutic agent is being used, the route of administration, and the size (body weight, body surface or organ size) and / or condition (age and general health) of the patient. In certain embodiments, the doctor may titrate the dosage and modify the route of administration to obtain the optimal therapeutic effect. In certain embodiments, a typical dosage can range from about 0.1 μ g / kg to up to about 100 mg / kg or more, depending on the factors mentioned above. In certain embodiments, the dosage can vary from 0.1 μ g / kg to about 100 mg / kg; or 1 μ g / kg at about 100 mg / kg; or 5 μ g / kg up to about 100 mg / kg.
[0207] In certain embodiments, the frequency of dosing will be taken according to the pharmacokinetic parameters of a hybrid nuclease molecule and / or any additional therapeutic agents in the formulation used. In certain embodiments, a medium will administer the composition until a dosage is achieved that achieves the desired effect. In certain embodiments, the composition can therefore be administered as a single dose, or as two or more doses (which may or may not contain the same amount of the desired molecule) over time, or as a continuous infusion via a delivery device. implantation or catheter. In addition, refinement of the appropriate dosage is routinely done by those skilled in the art and is within the scope of the tasks routinely performed by them. In certain embodiments, the appropriate dosages can be adjusted using appropriate dose response data.
[0208] In certain embodiments, the route of administration of the pharmaceutical composition is in accordance with known methods, for example, orally, through intravenous, intraperitoneal, intracerebral (intraparenchymal), intracerebroventricular, intramuscular, subcutaneously, intraocular, intraarterial injection , intraportal, or intralesional routes; through sustained release systems, or by implantation devices. In certain embodiments, the compositions can be administered by bolus injection or continuously by infusion, or via an implantation device.
[0209] In certain embodiments, the composition can be administered locally via implantation of a membrane, sponge or other suitable material on which the desired molecule has been absorbed or encapsulated. In certain embodiments, where an implantation device is used, the device can be implanted into any appropriate tissue or organ, and the release of the desired molecule can be via diffusion, determined release bolus, or continuous administration.
[0210] In certain embodiments, it may be desirable to use a pharmaceutical composition comprising a hybrid nuclease molecule, with or without at least one additional therapeutic agent, in an ex vivo manner. In said examples, cells, tissues and / or organs that have been removed from the patient are exposed to a pharmaceutical composition comprising a hybrid nuclease molecule, with or without at least one additional therapeutic agent, after which cells, tissues and / or organs are subsequently implanted back into the patient.
[0211] In certain embodiments, a hybrid nuclease molecule and / or any additional therapeutic agents can be released by implanting certain cells that have been genetically engineered, using methods such as those described here, to express and secrete the polypeptides. In certain embodiments, said cells can be animal cells or human cells, and can be autologous, heterologous, or xenogenic. In certain embodiments, the cells can be immortalized. In certain embodiments, in order to decrease the chance of an immune response, cells can be encapsulated to prevent infiltration of surrounding tissues. In certain embodiments, encapsulation materials are typically bio-compatible, semi-permeable polymeric wraps or membranes that allow the release of the protein product, but prevent the destruction of cells through the patient's immune system or through other harmful factors from tissues around.
[0212] The hybrid nuclease molecules of the present invention are particularly effective in the treatment of autoimmune disorders or abnormal immune responses. In this regard, it should be appreciated that the hybrid nuclease molecules of the present invention can be used to control, suppress, modulate, treat, or eliminate unwanted immune responses for both, external and autoantigens. In yet another embodiment, the polypeptides of the present invention can be used to treat immune disorders that include, but are not limited to, insulin-dependent diabetes mielitus, multiple sclerosis, experimental autoimmune encephalomyelitis, rheumatoid arthritis, experimental autoimmune arthritis, myasthenia gravis, thyroiditis, an experimental form of uveoretinitis, Hashimoto's thyroiditis, primary myxoedema, thyrotoxicosis, pernicious anemia, autoimmune atrophic gastritis, Addison's disease, premature menopause, male infertility, juvenile diabetes, Goodpasture's syndrome, Pemphigus vulgaris, pemphigus, ophthalmia phagogenic, autoimmune hemolytic anemia, idiopathic leukopenia, primary biliary cirrhosis, chronic active hepatitis Hbs-ve, cryptogenic cirrhosis, ulcerative colitis, Sjogren's syndrome, scleroderma, Wegener's granulomatosis, polymyositis, dermatomyositis, discoid LE, lupus erythematosus and connective tissue disease. KIT
[0213] A kit can include a hybrid nuclease molecule described here and instructions for use. The kits may comprise, in an appropriate container, a hybrid nuclease molecule described herein, one or more controls, and various buffers, reagents, enzymes and other standard ingredients well known in the art.
[0214] The container can include at least one vial, well, test tube, vial, bottle, syringe, or other container means, into which a hybrid nuclease molecule can be placed, and in some instances, properly aliquoted. When an additional component is provided, the kit can contain additional containers into which this component can be placed. The kits may also include a means to contain the hybrid nuclease molecule and any other container for reagent in close confinement for commercial sale. Said containers can include injection or blow molded plastic containers into which the desired vials are retained. Containers and / or kits may include a label with instructions for use and / or observations. EXAMPLES
[0215] Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any sense. Efforts have been made to ensure accuracy with respect to the numbers used (for example, quantities, temperatures, etc.), but some experimental errors and deviations must, of course, be taken into account.
[0216] The practice of the present invention will employ, unless otherwise indicated, conventional methods of protein chemistry, biochemistry, recombinant DNA techniques and pharmacology, within the technical field. These techniques are fully explained in the literature. See, for example, “T.E. Creighton, Proteins: Structures and Molecular Properties (W.H. Freeman and Company, 1993); A.L. Lehninger, Biochemistry (Worth Publishers, Inc., current addition); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); Remington's Pharmaceutical Sciences, 18th Edition (Easton, Pennsylvania: Mack Publishing Company, 1990); Carey and Sundberg Advanced Organic Chemistry 3rdEd. (Plenum Press) Vols A and B (1992) ”. Example 1: General approach for the production of hybrid nuclease molecules.
[0217] The hybrid nuclease molecules were designed to incorporate the desired structures and functional activity of single enzyme or multiple enzyme structures such as modular cassettes with compatible restriction enzyme sites to transfer and exchange domains. The schematic structure of the different embodiments of the hybrid nuclease molecules is illustrated in Figure 1. The nucleotide and amino acid sequences of representative hybrid nuclease molecules are shown in Table 1.
[0218] Human cDNAs were isolated from human pancreas RNA (Ambion) or human PBMC RNA obtained from normal human peripheral blood lymphocytes (approximately 5x10e6) using QIAgen RNAeasy kits (Valencia, CA) and QIAshredder kits to homogenize cell lysates (QIAgen, Valencia, CA). Human PBMCs were isolated from heparinized human blood diluted 1: 1 in D-PBS and distributed in layers over the LSM lymphocyte separation medium (MP Biomedicals, Irvine, CA), Ficcol gradients.
[0219] Mouse spleen RNA was isolated using QIAgen RNAeasy kits (Valencia, CA), of approximately 5x10 and 6 splenocytes. The cells were pelleted by centrifugation from the culture medium, and 5x10 and 6 cells were used to prepare the RNA. The RNA was isolated from the cells using the QIAGEN RNAeasy kit (Valencia, Calif.) Total RNA isolation kit and QIAGEN QIAshredder according to the manufacturer's instructions accompanying the kit. One to two micrograms (1-2 μ g) of the total RNA was used as a model to prepare the cDNA through reverse transcription. The RNA, 300 ng of random primers, and 500 ng of Oligo dT (12-18), and 1 μl of 25 mM dNTPs were combined and denatured at 80 ° C for 5 minutes before adding the enzyme. The Superscript III reverse transcriptase (Invitrogen, Life Technologies) was added to the RNA plus the primer mixture in a total volume of 25 μl in the presence of 5 times the second tape buffer and 0.1 M of DTT provided with the enzyme. The reverse transcription reaction was allowed to proceed at 50 ° C for one hour.
[0220] Between 10-100ng of the cDNA were used in the PCR amplification reactions using specific primers for the nuclease gene of interest (RNaseA, RNase1, DNase1, TREX1, DNase1L3, etc.) For the initial cloning reactions, the primers were designed to isolate the full length of the cDNA or truncation products encoding the gene of interest. The full extension or reduced PCR fragments were isolated by agarose gel electrophoresis, and purified using Qiagen QIAquick columns to remove unwanted nucleotides, primers, and amplified products. The purified fragments were cloned into pCR2.1 TOPO cloning vectors (Invitrogen, Carlsbad, CA) and transformed into TOP10 competent bacteria. The isolated colonies were transferred to the Luria broth medium containing 50 µg / ml carbenicillin, and grown overnight to isolate the plasmids. TOPO clones were classified in inserts to the correct size by digestion with restriction enzyme EcoRI (NEB, Ipswich, MA) and agarose gel electrophoresis of the digested fragments. The DNA sequence analysis of the positive clones was performed with the ABI Ready v3.1 reaction mixture and analyzed using an ABI 3730 XL DNA sequencer. Once the correct clones were obtained, further modifications to the sequences were designed and the PCR reactions carried out to produce the desired alleles or the desired expression cassettes. The truncation products and alleles were generated by PCR mutagenesis using overlap primers to introduce the mutations at specific positions in the genes. The ligands were synthesized by overlapping PCR using internal overlapping primers and successive rounds of PCR to link the additional sequence to each terminal. The hybrid nuclease molecules were arranged as a strip of several interleaved cassettes. The molecules of the preferred embodiment contain a fixed leader peptide, a nuclease cassette, an optional cassette encoding a choice of several different polypeptide ligands, a -Ig Fc domain cassette with both a stop codon (STOP) and a ligand at the carboxyl end of the CH3 domain, and for resolvICase-type molecules, a second binding cassette, followed by a second nuclease cassette. Figure 1 illustrates the cassette-like structure of these hybrid nuclease molecules and examples of potential sequences inserted at each position. Once the hybrid nuclease molecules were arranged, they were transferred to an appropriate mammalian expression plasmid pDG for transient expression in COS7 or other cells and stable expression in CHO DG44 cells using selection for DHFR with methotrexate. Transient expression of hybrid nuclease molecules
[0221] COS-7 cells were transiently transfected with pDG expression vector containing the inserts of the genes of the hybrid nuclease molecule. The day before transfection, cells were seeded on a 60 mm disc at 4x10 and 5 cells in 4 ml of DMEM (ThermoFisher / Mediatech cell gro) + 10% FBS of tissue culture medium. The DMEM basal medium was supplemented with 4.5 g / L of glucose, sodium pyruvate, 4 mM L-glutamine, and non-essential amino acids. Fetal bovine serum (Hyclone, Logan, UT ThermoFisher Scientific) was added to the medium in 10% of the final volume. The cells were incubated at 37 ° C, 5% CO2, overnight and were approximately 40-80% confluent on the day of transfection. Plasmid DNA was prepared using Qiagen QIAprep miniprep kits (Valencia, CA) according to the manufacturer's instructions, and eluted in 50 µl EB buffer. DNA concentrations were measured using a Nanodrop 1000 spectrophotometer (Thermo Fisher Scientific, Wilmington DE). Plasmid DNA was transfected using the Polyfect transfection reagent (Qiagen, Valencia, CA) according to the manufacturer's instructions, using 2.5 μg of plasmid DNA per 60 mm disc and 15 μl of Polyfect reagent in 150ul serum free from the DMEM transfection cocktail. After complex formation, the reactions were diluted within 1 ml of the cell growth medium containing serum and all supplements, and added dropwise to plates containing 3 ml of fresh DMEM complete culture medium. Transient transfections were incubated for 48-72 hours before collection of culture supernatants for further analysis. Production of the stable CHO DG44 transfectants expressing the hybrid nuclease molecules of interest.
[0222] Stable production of the hybrid nuclease molecules was achieved by electroporation of a selectable, amplifiable plasmid, pDG, containing the nuclease-Ig cDNA under the control of the CMV promoter, inside the Chinese Hamster ovary (CHO) cells. The pDG vector is a modified version of pcDNA3 encoding the selectable marker DHFR with an attenuated promoter to increase the selection of pressure for the plasmid. Plasmid DNA was prepared using maxi-prepared Qiagen kits, and the purified plasmid was linearized to a single AscI site before extraction with phenol and ethanol precipitation. Salmon sperm DNA (Sigma-Aldrich, St. Louis, Mo.) was added as a DNA carrier, and 100 mg of each of the plasmids and DNA carrier was used to transfect 107 CHO DG44 cells by electroporation. The cells were grown in the log phase in Excell 302 medium (JRH Biosciences) containing glutamine (4 mM), pyruvate, recombinant insulin, penicillin-streptomycin, and 2xDMEM non-essential amino acids (all from Life Technologies, Gaithersburg, Md.), hereinafter referred to as “Excell 302 complete” medium. The medium for non-transfected cells also containing HT (Diluted with a 100x solution of hypoxanthine and thymidine) (Invitrogen / Life Technologies). The medium for transfections under selection containing varying levels of methotrexate (Sigma-Aldrich) as a selective agent, ranging from 50 nM to 1 μM. Electroporations were performed at 280 volts, 950 microFarads. The transfected cells were left to recover overnight in non-selective medium prior to selective plating on 96-well flat-bottom plates (Costar) in serial dilutions ranging from 125 cells / well to 2000 cells / well. The culture medium for cell cloning was complete Excell 302, containing 50 nM methotrexate. Once the clonal growth was sufficient, the serial dilutions of the culture supernatants from the main wells were classified for expression of the hybrid nuclease molecules by using an ELISA-IgG sandwich. Briefly, the NUNC Immulon II plates were coated overnight at 4 ° C with 7.5 microgram / ml of goat anti-mouse IgG F (ab'2) (KPL Labs, Gaithersburg, MD) or 2 µg / ml of Goat anti-mouse or anti-human IgG (Jackson Immunoresearch, West Grove PA) in PBS. The plates were blocked in PBS / 2-3% BASA, and serial dilutions of the culture supernatants incubated at room temperature for 2-3 hours. The plates were washed three times in PBS / 0.05% Tween 20, and incubated with horseradish peroxidase conjugate and IgG2 to goat anti-mouse F (ab'2) (Southern Biotechnologies) and anti-mouse IgG goat (KPL) mixed together, each 1: 3500 in PBS / 1.0% BSA, or horseradish peroxidase conjugated to goat anti-human IgG1 F (ab'2) (Jackson Immunoresearch, West Grove, PA) in 1: 2500 for 1-2 hours at room temperature. The plates were washed four times in PBS / 0.05% Tween 20, and binding detected with SureBlue Reserve, TMB substrate (KPL Labs, Gaithersburg, MD). The reactions were stopped by adding an equal volume of 1N HCl, and plates read at 450nM in a Spectramax Pro plate reader (Microdevices, Sunnyvale CA). The clones with the superior production of the hybrid nuclease molecule were expanded in T25 and then T75 flasks to provide adequate numbers of cells for freezing and for progressive production of the fusion protein. Production levels were further increased in cultures of four best clones by progressive amplification in the culture medium containing methotrexate. On each successive cell pass, the complete Excell 302 medium containing an increased concentration of methotrexate, so that only cells that amplified the DHFR plasmid could survive.
[0223] Supernatants were harvested from CHO cells expressing the hybrid nuclease molecule, filtered through 0.2 μm PES expression filters (Nalgene, Rochester, NY) and passed over a Protein A-agarose column (IPA 300 cross-linked agarose) (Repligen, Needham, Mass.). The column was washed with column wash buffer (90mM Tris-Base, 150mM NaCl, 0.05% sodium azide, pH 8.7), and the binding protein was eluted using 0.1 M buffer citrate, pH 3.0. The fractions were harvested and the protein concentration was determined at 280nM using a Nanodrop micro-sample spectrophotometer (Wilmington DE), and the blank determination using 0.1 M of the citrate buffer, pH 3.0. The fractions containing the hybrid nuclease molecules were fused, and the buffer exchange performed by serial spindles in PBS using Centricon concentrators followed by filtration through 0.2 μ m filter devices, to reduce the possibility of endotoxin contamination. Example 2: Construction of RNase-Ig fusion genes
[0224] Murine RNase 1 was amplified as a full-length cDNA from an EST bank (from Dr. C. Raine, Albert Einstein School of Medicine ”, Bronx, NY) that sent the clone to our laboratory without a MTA. The specific sequence of the 5 'and 3' primers used were from the published sequences. The sequence of the clone was verified through sequencing analysis. The Genebank accession number is NCB1 geneID 19752. Full-length human RNase 1 was isolated from randomized preparations and cDNA prepared from human pancreatic RNA derived from human pancreas (Ambion / Applied BIosystems, Austin, TX).
[0225] Once the full-length clone was isolated, primers were designed to create a fusion gene with the mouse IgG2a or human IgG1 Fc domains (SEQ ID NO: 40). Two different primers were assigned to the 5 'sequence fused at the amino terminus of the Fc tail; the first incorporated into the native leader peptide from mouse (or human) RNase, while the second linked to an AgeI site for the amino terminal of RNase at the predictable signal peptide cleavage site in order to fuse RNase to a leader peptide Human VKIII that had already been cloned and used for other expression studies. For murine RNase, the first primer sequence is: mribNL5 '30mer (RNase 5' with native leader and HindIII + Kozak) gTT AAg CTT gCC ACC ATg ggT CTg gAg AAg TCC CTC ATT CTg-3 '(SEQ ID NO: 1)
[0226] The second primer creates a gene fusion junction between an existing leader sequence and the mature sequence at the 5 'end of RNase, at or near the predicted leader peptide cleavage site. 27mer (RNase 5 'mature sequence (no leader, with AgeI site) 5'-gAT ACC ACC ggT Agg gAA TCT gCA gCA CAg AAg TTT CAg-3' (SEQ ID NO: 2)
The primer sequence 3 'for fusion to murine IgG2a at the carboxy end of RNase and the amino terminus of the Fc tail is as follows: mrib3NH2 28mer (RNase at the 3' end with XhoI site for fusion to mIgG2a). 5’-ggC TCg AgC ACA gTA gCA TCA AAg tGG ACT ggT ACg TAg g-3 ’(SEQ ID NO: 3)
[0228] Two more oligos have been designed to create a -Ig-RNase fusion gene, where the -Ig tail is an amino terminus for the RNase enzyme domain. mrib5X 36mer RNase at the 5 'end with the leader aa and the XbaI site for fusion at the carboxy end of the Fc domain. 5'-AAA TCT AgA CCT CAA CCA ggT Agg gAA TCT gCA gCA CAg AAg TTT CAg-3 '(SEQ ID NO: 4) mrib3X 31mer RNase at the 3' end with two stop codons and XbaI site for fusion to the carboxy end of the Fc domain. 5'-TCT AgA CTA TCA CAC AgT AgC ATC AAA gTg gAC Tgg TAC gTA g- 3 '(SEQ ID NO: 5) Example 3: Isolation of the mouse and human Fc domains and introduction of mutations in the coding sequence
[0229] For isolation of the mouse and human Fc domains (SEQ ID NO: 40), the RNA was derived from human or mouse tissues as follows. A single cell suspension was generated from the mouse spleen in RPMI culture medium. Alternatively, human PBMCs were isolated from fresh media, all blood using lymphocyte separation media (LSM), Organon Teknika (Durham, NC), layer of white cells harvested according to the manufacturer's instructions, and cells washed three times in PBS before use. The cells were pelleted by centrifugation of the culture medium, and 2x107 cells were used to prepare the RNA. The RNA was isolated from the cells using the QIAGEN RNAeasy kit (Valencia, Calif.) From the total RNA isolation kit and QIAGEN QIAshredder columns, according to the manufacturer's instructions accompanying the kits. A microgram (4 μ g) of the total RNA was used as a model to prepare the cDNA through reverse transcription. The RNA, 300 ng of the random primers, and 500 ng of the Oligo dT (12-18), and 1 μl of 25 mM dNTPs were combined and denatured at 80 ° C for 5 minutes before adding the enzyme. Superscript III reverse transcriptase (Invitrogen, Life Technologies) was added to the RNA plus the primer mixture in a total volume of 25 μl in the presence of the second tape buffer and 0.1 M DTT provided with the enzyme. The reverse transcription reaction was allowed to proceed at 50 ° C for one hour. The cDNA was purified using QIAquick PCR purification columns (QIAGEN) according to the manufacturer's instructions, and eluted in 40 microliters of EB buffer before use in PCR reactions.
[0230] The mouse and human allele-wild Fc domains were isolated by PCR amplification using the cDNA described above as a model. The following primers were used for the initial amplification of the allele-wild sequence, but incorporated into the desired mutational changes in the articulation domain: mahIgG1CH2M: 47 mer 5'-tgtccaccgtgtccagcacctgaactcctgggtggatcgtcagtcttcc-3 '(SEQ ID NO: 6 hIc 5: 5) agatctcgagcccaaatcttctgacaaaactcacacatgtccaccgtgt 5'-3 '(SEQ ID NO: 7) mahIgG1S: 51-mer 5'tctagattatcatttacccggagacagagagaggctcttctgcgtgtagtg-3' (SEQ ID NO: 8) muIgG2aCH2: cctccatgcaaatgcccagcacctaacctcttgggtggatcatccgtcttcatcttcc 58mer 5'-3 '(SEQ ID NO: 9) mIgG2a -5scc: 47mer 5'-gaagatctcgagcccagaggtcccacaatcaagccctctcctcca-3 '(SEQ ID NO: 10) mIgG2a3S: 48mer 5'-gtttctagattatcatttacccggagtccgagagaagctcttagtcgt-3' (SEQ ID:
[0231] PCR reactions were performed using a C1000 thermal cycler (BioRad, Hercules CA) or an Eppendorf thermal cycler (ThermoFisher Scientific, Houston TX). The reactions include an initial denaturation step at 95 ° C for 2 minutes, followed by 34 cycles with 94 ° C, 30 seconds of denaturation, 50 ° C, 30 seconds of annealing, and 72 ° C, 1 minute of the extension step , followed by a final 4 minute extension at 72 ° C. Once allele-wild tails were isolated, the TOPO fragments were cloned into pCR2.1 vectors, the DNA prepared using the QIAGEN spin plasmid mini-kits according to the manufacturer's instructions and sequentially cloned using ABI sequencing reactions Dye Terminator v3.1 according to the manufacturer's instructions.
[0232] DNA from the correct clones was used as a template in extending the PCR overlap to introduce the mutations at the desired positions in the coding sequence for mouse IgG2a or human IgG1. The PCR reactions were arranged using the full extent of wild allele clones as a model (1 microliter), 50 pmol of the 5 'and 3' PCR primers in each portion of the -Fc domain up to and including the desired mutation site at from each direction, and the Supermix high-fidelity PCR (Invitrogen, Carlsbad CA), in the reaction with 50 microliters of volume using a short amplification cycle. As an example of PCR overlap mutagenesis, the primer combination used to introduce the P331S mutation into human -IgG1, was as follows:
[0233] A 5 'subfragment was amplified using the full extension of the allele-wild clone as a model, and the 5' primer was hIgG1-5scc: 5'- agatctcgagcccaaatcttctgacaaaactcacacatgtccaccgtgt-3 '(SEQ ID NO: 12), although the primer 3 'was P331AS: 5'- gttttctcgatggaggctgggagggctttgttggagacc-3' (SEQ ID NO: 13). A 3 'subfragment was amplified using the full extension of the allele-wild clone as a model and the 5' primer was P331S: 5'aaggtctccaacaaagccctcccagcctccatcgagaaaacaatctcc-3 '(SEQ ID NO: 14), while the 3' primer was mahIgG1S: 5'- tctagattatcatttacccggagacagagagaggctcttctgcgtgtagtg-3 '(SEQ ID NO: 15).
[0234] Once the subfragments were amplified and isolated by agarose gel electrophoresis, they were purified by QIAquick gel purification columns and eluted in 30 microliters of EB buffer according to the manufacturer's instructions. Two rounds of the PCR were then performed with two subfragments as models of overlap in new reactions. The cycler was paused and the 5 '(hIgG1-5scc, see above) and 3' (mahIgG1S, see above) flank primers were added to the reactions (50 pmol each). The PCR amplifications were then performed in 34 cycles under the conditions described for the allele-wild molecule above. The full-length fragments were isolated by gel electrophoresis, and TOPO cloned into the pCR2.1 vectors for sequence analysis. The fragments of the clones with the correct sequence were then subcloned within the expression vectors to create the different hybrid nuclease molecules described above. Example 4:
[0235] Quantification of RSLV-124 protein and activity of RNase enzyme in mouse serum:
[0236] Analysis of in vivo stability in mice of the construct RSLV-124 (SEQ ID NO; 106)
[0237] Four mice (C220, C221, C222, C223) were injected intravenously with a single injection of RSLV-124 at time zero. Several periods after the injection, blood samples were collected and analyzed for the presence of the RSLV-124 protein (a human allele-wild RNase linked to a human allele-wild IgG1 Fc domain (SEQ ID NO: 106) and the enzyme activity To detect the compound RSLV-124 in the mouse serum, an ELISA was developed to capture human Fc from the mouse serum followed by the detection of human RNase. presence of RSLV-124 was detected within five minutes after a single 150 µg intravenous injection, between 38 μ g / ml to 55 μ g / ml (Figure 2). One day after the injection, the concentration of RSLV-124 dropped rapidly to between 8 μ g / ml to 12 μ g / ml The blood concentration of the drug remained relatively stable during the analysis up to seven days when the blood levels of the drug were approximately 5 μ g / ml. used to measure RSLV-124 protein by ELISA were used to quantify the RNase enzymatic activity of the drug. Ambion's RNaseAlert QC System (CA # AM 1966) was used to measure the enzyme kinetics of the RSLV-124 protein in the mouse blood samples with some modifications. The drug compound was captured from the mouse serum on the RNaseAlert evaluation plate using an anti-Fc monoclonal antibody and quantified by measuring fluorescence using the instructions in the Ambion kit. The analysis of the relative fluorescent units (RFU’s) of the RSLV-124 molecule demonstrated between 80,000 - 140,000 RFUs in five minutes after injection (Figure 3). The RFU’s declined rapidly in parallel with the protein concentration, remaining relatively stable between 18,000 - 40,000 RFU’s for day seven. The RnaseAlert QC system was used to develop a standard curve using known amounts of the protein, from this standard curve, the RSUV-124 RFU's in the blood sample were used to extrapolate the RSLV-124 protein concentration. From this analysis it was determined that the concentration of the protein present in the mouse blood in relation to the seven days of the experiment, as calculated using the evaluation of the enzyme activity of RNase were very similar to the values that were measured using the ELISA (Figure 4). From these experiments, it was concluded that the compound RSLV-124 is stable in vivo in the circulation of the mouse at seven days and retains its enzymatic activity, suggesting that the compound is not susceptible to degradation in vivo in the mouse since 100% of Enzymatic activity is retained during the seven days in circulation in the mouse. Since Fc fusion proteins are often susceptible to degradation in the circulation, this finding further confirms the use of RNase-Fc fusion proteins as valuable drugs. Example 5: Phenotype of transgenic double mouse TLR7.1xRNaseA
[0238] Mice were created that overexpress RNaseA (RNase Tg). This nuclease was expressed in high levels in mouse RNg Tg. Both, a single radial diffusion method (SRED) were developed (Figure 5 and a much larger amount of ELISA to quantify RNase in serum (Figure 6)). Both analyzes showed a significant increase in RNase activity in RNase Tg. Quantification of the level of RNase in Figure 6 compared to the B6 allele-wild mouse showed an approximately 10-fold increase in RNase in RNase Tg. RNase Tg was crossed with TLR7.1 mouse Tg to create the double Tg (DTg). The mouse TLR7.1 had 8-16 copies of TLR7 and developed a very aggressive disease, a rapidly progressive lupus-like disease, and initiated death at 3 months of age with an average survival of 6 months. In a preliminary analysis, the inventors bled DTg and the 3-month-old calf controls (“littermate”) to see if the DTg mice showed signs of improvement. As shown in figure 5, the DTg mice had very high levels of RNAse in their serum (equivalent to> 13 U / ml RNase based on our standard with the specific activity of 993 U / mg). The concentration of RNaseA in mouse Tg and DTg was also measured by ELISA analysis as shown in Figure 6. The RNaseA Tg and TLR7.1XRNase The mouse Dtg had serum RNase concentrations between 1-2 ng / ml. Detailed method for RNase A ELISA 1. Abcam Ab (ab6610) coated anti-RNase A plate: 2.5-10 μ g / ml O / N in 4C 2. Wash plate 3 times with 0.05% Tween / 1XPBS 3. Block with 1% BSA in PBS for at least 1 hour 4. Wash plates 3 times with 0.05 Tween / 1XPBS 5. Load the samples. Sample dilutions 1:50 6. Incubate at room temperature for 2 hours 7. Wash plates 3 times with 0.05% Tween / 1XPBS. 8. Prepare the dilution of biotin Ab labeled anti-RNase in a dilution of 1: 4500 (2.2 μ g / ml). 9. Wash the plate 3 times 10. Dilute StrepAV HRP (Biolegedn 405210) 1: 2500. Cover with foil and sheet at room temperature (RT) for 25-30 minutes 11. Wash 6 times, let the liquid settle in the wells for at least 30 seconds between washes 12. Add BD OptEIA A + B substrate 1: 1 . Wait until the color changes 5-10 minutes maximum. Do not let the well standard exceed 1.0. Add 80 μ L. (CatNos .: 51- 2606KC, Reagent A, 51-2607KC; Reagent B) 13. Add 40μ l of 1M sulfuric acid to stop the reaction. Product / Reagent Information: RNaseA Ab: ab6610 (90 mg / ml) ELISA Buffer: 1% BSA in PBS ELISA Wash Buffer: 0.05% Tween / 1XPBS Anti-RNaseA Ab biotin Conjugate: Rockland: 200-4688 ( 10 mg / ml) Strep AV HRP: Biolegend 405210 BD OptEIA A and B reagent: 51-2606KC and 51-2607KC Example 6: Survival curves for TLR7.1 transgenic mouse strains
[0239] There is a significantly greater difference in DTg and TLR7.1 controls in survival. As shown in Figure 7, in 10 months, 61% of the mouse's TLR7.1 was killed, while 31% of DTg mice died. This data shows that RNaseA overexpression had a strong therapeutic effect. The reasons why TLR7.1 mice died prematurely were not completely clear, although severe anemia, thrombocytopenia, and glomerulonephritis may play a part. To determine whether the red cell and platelet count were positively impacted by RNaseA expression in DTg mice, we performed a blood count, but did not see any differences between TLR7.1 and DTg mice. In contrast, there is a significant improvement in kidney histopathology in DTg mice. Decreased deposition of IgG and C3 was observed in DTg mice. PAS staining, which reflects inflammation in mesangios, was also reduced in DTg mice compared to TLR7.1 controls in the litter (“littermate”). When the inventors compared the infiltration of kidney macrophages using the anti-MAC-2 antibody (galectin 3) (Lyoda et al., “Nephrol Dial Transplat.”, 22: 3451, 2007), there were very few Mac-2 positive cells in the glomeruli of DTg mice. The results of counting 20 glomeruli per mouse in 5 mice in each group revealed an average +/- SE of 3.8 +/- 1.1 and 1.4 +/- 0.2 for a single versus DTg respectively, p = .05. In addition, the size of the glomerular tufts (“glomerular tuft”) was quantified and a significant reduction in the size of the glomerular tufts was observed in the DTg mice (179 +/- 41 versus 128 +/- 16.8 um2 in a single versus DTg respectively , p = 0.037). In summary, TLR7.1XRNaseA DTg mouse survives longer than its offspring TgTLR7.1 alone and has less inflammation and damage to its kidneys. Example 7: Analysis of IRGs in spleen of TLR Tg mice.
[0240] Analysis of the interferon response genes (IRgs) in the spleens of TLR7.1 Tg mice and TLR7.1XRNase DTg mice showed that the expression of the IRF7 gene was significantly lower in DTg mice (p = 0.03). Some other IRGs including MX1 (GTP-binding protein induced by interferon Mx1 (UniProtKB P09922)) and V1G1 (Methionine domain S-adenosyl radical containing protein 2 (UniProtKB Q8CBB9)) were smaller in DTg mice compared to the Tg mouse, but the differences were not significant (figure 8). Quantitative PCR was performed as follows: Total RNA was isolated from the spleen of mice using the mini RNeasy kit (QIagen, Valencia, CA, USA), DNase treated using Turbo DNA-free (Applied Biosystems, Foster City, CA, USA) and the first strand cDNA was produced with the RNA-to-cDNA kit (Applied Biosystems) using random primers. The 260/280 was between 1.7 and 2.0 for the isolated RNA measured with a NanoDrop (Thermo Scientific, Waltham, MA, USA). The cDNA was diluted in an equivalent of 1 ng / ul of the total RNA and 8ul were used by reaction. The primers for the reference gene (18s) and the genes of interest (GOI) were synthesized (IDT, Coralville, Iowa, USA) and diluted to concentrations appropriate for qPCR using molecular water. The BLAST results of the primers demonstrated sequence specific homology only for the reference gene or GOI. Duplicate reactions (20ul) were run on an ABI Fast 7500 system using a 1: 1 mix of model and primer for the SensiMix SYBR Low-ROX master mix (Bioline, London, UK). Relative quantification was calculated using the 2-ddCT method with approximate age of B5 allele-wild mice as a baseline to determine fold changes for each GOI. The dissociation curves for the reactions demonstrated a single fusion peak for each gene. The standard curve demonstrated similar amplification efficiency for each gene and that the concentrations of the model were within the linear dynamic range for each of the primer set. Example 8: Construction and expression of single DNase1-Ig and two hybrid nuclease molecules of the enzyme.
[0241] Naturally occurring alleles of human DNase1 or DNase1-type molecules have been reported. The A114F mutation has previously been reported to occur in natural variants of human DNase1 type enzymes, and to result in actin resistance of enzymes containing this sequence change. See Pan, CQ, Dodge TH, Baker DL, Prince WE, Sinicropi DV, and Lazarus RA. "J. Biol. Chem. ”, 273: 18374-18381, (1998); Zhen A, Parmelee D, Hyaw H, Coleman TA, Su K, Zhang J, Gentz R, Ruben S, Rosen C, and Li Y. “Biochem. and Biophys. Res. Comm. ”, 231: 499-504 (1997); and Rodriguez AM, Rodin D, Nomura H, Morton CC, Weremowicz S, and Schneider MC. Genomics 42: 507-513 (1997), all of which are incorporated herein by Reference.
[0242] Similarly, the G105R mutation was recently reported as a single nucleotide polymorphism in the gene encoding human DNase1 that was polymorphic in some or all populations, and which is relevant to autoimmunity. (See Yasuda t., Ueki M., Takeshita H., Fujihara J, Kimura-Kataoka K, Lida R, Tsubota E, Soejima M, Koda Y, Dato H, Panduro A. “Int. J. Biochem. Cell. Biol ”42 (7): 1216-1225 (2010), incorporated herein by reference). The allelic variants in this position resulted in high activity of the DNase1 isoforms housed in relation to the wild allele. Another naturally occurring polymorphic mutation (R21S) has also been reported to confer increased activity (See Yasuda, supra).
[0243] SLE patients have been reported to have significantly decreased levels of DNase1 activity (See, Martinez-Valle F, Balada E., Ordi-Ros J, Bujan-Rivas S., Sellas-Fernandez A., Vilardell-Tarres M. , Lupus 18 (5): 418423 (2009), incorporated herein by reference).
[0244] Naturally occurring enzyme variants may thus be less immunogenic when administered to patients, since these isoforms occur in the human population. We agree that the combination of the actin-resistant properties of the A114F-like alleles with the increased enzymatic activity of the G105R type alleles could produce new allelic variants of human DNase1 that can demonstrate improved clinical activity in vitro and in vivo. To our knowledge, ours is the first report of this new mutant form of NDase1 generated from the combination of two naturally occurring variants G105R and A114F.
[0245] Human DNase1 was isolated as previously described from human pancreatic RNA (Ambion), by randomly prepared cDNA and PCR using the following primer set: 5'hDNase1-age: GTT ACC GGT CTG AAG ATC GCA GCC TTC AAC ATC CAG (SEQ ID NO: 16). 5’hDNase1-bx: GTT CTC GAG ATC TTT CAG CAT CAC CTC CAC TGG ATA GTG (SEQ ID NO: 17).
[0246] Alternatively, the 3 'DNase cassettes were amplified by PCR using the following primer pair: 3'hDNase1-RV: GTT GAT ATC CTG AAG ATC GCA GCC TTC AAC ATC CAG (SEQ ID NO: 18). 3’hDNase1-stop: GTT TCT AGA TTA TCA CTT CAG CAT CAC CTC CAC TGG ATA GTG (SEQ ID NO: 19).
[0247] PCR reactions were performed using 50 pmol in each primer, 2 µl cDNA, in a total volume of 50 µl using a Supermix Platinum PCR, as previously described. The amplification profile was 94C, 30 seconds; 55C, 30 seconds; 68C, 90 seconds, for 35 cycles.
[0248] Once the wild allele gene was amplified by PCR, the fragments were subjected to gel electrophoresis and 850 bp fragments purified by QIAquick column purification. The fragments were cloned into pCR2.1, transformed by TOPO clone according to the manufacturer's instructions as described for the other constructs. Once the sequence was verified, PCR primers were used to produce subfragments containing naturally occurring alleles for DNase 1 that were reported to improve specific activity and improve resistance to actin inhibitory activity. These subfragments contained in the overlapping sequence, allowing the amplification of the complete DNAse1 subclones containing the desired allelic variations. COS7 cells were transiently transfected on 60 mm disks using the Polyfect transfection reagent (Qiagen, Valencia, CA). Plasmid DNA was prepared using the Qiagen QIAPrep mini-preparation kits according to the manufacturer's instructions. Plasmids were eluted in 50 µl of EB buffer. The DNA concentration was measured using Nanodrop and an aliquot equivalent to 2.5 μ g of the plasmid DNA used for each transfection reaction. Each DNaseIg or RNase-Ig-DNAse expression cassette was inserted into the mammalian expression vector pDG, a derivative of pcDNA3.1. The transfected cells were incubated for 72 hours at 37 ° C, 5% CO2 before being harvested from the culture supernatants for further analysis. The culture supernatants were harvested, the residual cells centrifuged from the solution, and the liquid transferred to new tubes.
[0249] COS7 cells were transiently transfected with plasmids containing human DNase 1 wild allele or naturally occurring DNase1 mutant alleles (G105R and / or A114F) fused to the Fc domain of human allele-wild IgG1. This hinge CH2-CH3 cassette contains a single C ^ S mutation in the hinge region to eliminate the first cysteine in this domain since it does not match due to the absence of its matching partner present in the antibody light chain. In addition, more multi-nuclease fusion protein complexes were also expressed from the transient transfections of the COS cell. Example 9: Isolation of human Ig tails, introduction of mutations within the coding sequence, and construction of mutant nuclease molecules
[0250] For isolation of the mutant human Ig Fc domains, the RNA was derived from human PBMCs isolated from all fresh blood, using lymphocyte separation medium (LSM), Organon Teknika (Durham, NC), layer of harvested white cells according to the manufacturer's instructions, and the cells were washed three times in PBS before use. The cells were pelleted by centrifugation from the culture medium, and 2x107 cells were used to prepare the RNA. The RNA was isolated from the cells using the QIAGEN RNAeasy kit (Valencia, Calif.) The total RNA isolation kit and the QIAGEN QIAshredder columns, according to the manufacturer's instructions accompanying the kits. A microgram (1 μ g) of the total RNA was used as a model to prepare the cDNA through reverse transcription. The RNA, 300 ng of the random primers, and 500 ng of the Oligo dT (12-18), and 1 μl of 25 mM dNTPs were combined and denatured at 80 ° C for 5 minutes before adding the enzyme. Superscript III reverse transcriptase (Invitrogen, Life Technologies) was added to the RNA plus the primer mixture in a total volume of 25 μl in the presence of the second tape buffer and 0.1 M DTT provided with the enzyme. The reverse transcription reaction was allowed to proceed at 50 ° C for one hour. The cDNA was purified using QIAquick PCR purification columns (QIAGEN) according to the manufacturer's instructions, and eluted in 40 microliters of EB buffer before use in PCR reactions.
[0251] Human allele-wild Ig Fc domains were isolated by PCR amplification using the cDNA described above as a model. The Ig-mutant fragments were isolated by PCR-directed mutagenesis, using the PCR primers containing the desired mutations and the wild-allele cassette as a template. PCR reactions were performed using a C1000 thermal cycler (BioRad, Hercules CA). The reactions included an initial denaturation step at 95 ° C for 2 minutes, followed by 34 cycles with a denaturation at 94 ° C for 30 seconds, 55 ° C, 30 seconds of annealing, and 72 ° C, 1 minute in a this extension, followed by a final extension of 4 minutes at 72 °. Once full-length mutant tails were isolated, the TOPO fragments were cloned into pCR2.1 vectors, the DNA prepared using the QIAGEN spin plasmid miniprep kit, according to the manufacturer's instructions, and the sequenced clones using sequencing reactions in ABI DYE v3.1 terminals, according to the manufacturer's instructions.
[0252] The recombinant molecules were generated by PCR mutagenesis using extension overlap PCR with altered oligonucleotides.
[0253] The following oligonucleotides were used to derive these molecules. CS-P238S 5-1: TCT CCA CCG AGC CCA GCA CCT GAA CTC CTG GGA GGA TCG TCA GTC TTC CTC TTC CCC C (58mer) (SEQ ID NO: 20) SSSH-5-2: AGA TCT CGA GCC CAA ATC TTC TGA CAA AAC TCA CAC ATC TCC ACC GAG CCC AGC ACC T (58 mer) (SEQ ID NO: 21) P331S-S: GTC TCC AAC AAA GCC CTC CCA GCC TCC ATC GAG AAA ACC ATC TCC A (46mer) (SEQ ID NO: 22) P331S-AS: TGG AGA TGG TTT TCT CGA TGG GGG CTG GGA GGG CTT TGT TGG AGA CC (47mer) (SEQ ID NO: 23) hIgG1-3'WTnogt: TCT AGA TTA TCA TTT TCC CGG AGA GAG AGA GAG GCT CTT CTG CGT GTA GTG (51mer) (SEQ ID NO: 24)
[0254] The P238S mutation and SSS substitutions for SCC were introduced by PCR mutagenesis using two 5 'overlapping oligos in the PCR sequential reactions. The first PCR reaction included the following 5 'primer which incorporates the P238S mutation within its sequence: CS-P238S 5-1: TCT CCA CCG AGC CCA GCA CCT GAA CTC CTG GGA GGA TCG TCA GTC TTC CTC TTC CCC C ( 58mer). (SEQ ID NO: 25).
[0255] The second PCR reaction included the 5 'primer after which superimposed the first primer and added over the joint residues landed on the P238S mutant: SSSH-5-2: AGA TCT CGA GCC CAA ATC TTC TGA CAA AAC TCA CAC ATC TCC ACC GAG CCC AGC ACC T (58 mer). (SEQ ID NO: 26).
[0256] The DNA of the correct clones was used as a model in extending the overlap of the PCRs to introduce the mutations at the desired internal positions in the coding sequence for human -IgG1. The PCR reactions were arranged using the full extension of the clones as a model (1 microliter), 50 pmol of the 5 'and 3' primers for the PCR in each portion of the tail -Ig to the e including the desired mutation site from each direction, and the Supermix hi high-fidelity PCR (Invitrogen, Carlsbad CA), in 50 microliter reaction volumes using a short amplification cycle. As an example of PCR overlap mutagenesis, the primer combination used to introduce the P331S mutation into human -IgG1, with the P238s mutation already introduced as follows:
[0257] A 5 'subfragment was amplified using the full extension of the allele-wild clone as a model, and the 5' primer was SSSH-5-2: AGA TCT CGA GCC CAA ATC TTC TGA CAA AAC TCA CAC ATC TCC ACC GAG CCC AGC ACC T (58 mer), while the 3 'primer was P331S-AS: TGG AGA TGG TTT TCT CGA TGG GGG CTG GGA GGG CTT TGT TGG AGA CC (47mer). (SEQ ID NO: 27).
[0258] A 3 'subfragment was amplified using the full extension of the allele-wild clone as a model and the 5' primer: P331S-S: GTC TCC AAC AAA GCC CTC CCA GCC TCC ATC GAG AAA ACC ATC TCC A (46mer), while the 3 'primer was hIgG1- 3'WTnogt: TCT AGA TTA TCA TTT TCC CGG AGA GAG AGA GAG GCT CTT CTG CGT GTA GTG (51mer). (SEQ ID NO: 28).
[0259] Once the subfragments were amplified and isolated by agarose gel electrophoresis, they were purified on QIAquick gel purification columns and eluted in 30 microliters of EP buffer according to the manufacturer's instructions. Two PCR runs were then performed with two subfragments as models of overlap in new reactions. The cycler was paused and the 5 'and 3' flank primers were added to the reactions (50 pmol each). The PCR amplifications were then performed for 34 cycles under the conditions described for the wild allele molecules above. The full-length fragments were isolated by gel electrophoresis, and the TOPO cloned into pCR2.1 vectors for sequence analysis. The fragments from the clones with the correct sequence were then subcloned within the expression vectors to create the different nuclease molecules described here.
[0260] For multispecific nuclease molecules, PCR reactions were performed using alternative primers for the 3 'end of the Fc domain, removing the STOP codon and adding the NLG linker and the EcoRV restriction site to the molecules to facilitate fusion the rest of the tape. The primer sequence was listed below: 5 'GAT ATC CTG CAC GCT AGG GCT GCT CAC ATT 3'. (SEQ ID NO: 29).
[0261] The RSLV nuclease mutants were constructed by fusing the Ig-altered tails for the wild-allele RNAse domain with the one without a ligand separating the two domains. RSLV 125 and RSLV126 merge human RNase into the mutant joint and the IgG1 Fc domain. RSLV125 does not contain ligand, while RSLV 126 contains the fragment (gli4ser) ligand as an inserted fragment (BgIII-XhoI) between the nuclease domain and the articulation regions. RSLV-125 incorporates an allele-wild Rnase cassette fused directly to the SSS (in addition to the CCC or allele-wild) version of the humaan IgG1 joint, and a human IgG1 Fc domain, P238S, P331S mutants (SEQ ID NO: 61-62).
[0262] RSLV 126 incorporates an allele-wild RNase cassette fused to a ligand domain (gli4ser), followed by the SSS mutant joint, and a P238s-P331S double mutant Fc domain (SEQ ID NO: 63-64).
[0263] RSLV-127 is a multinuclease fusion construct that incorporates an amino terminal human Dnase (G105R / A114F) fused to a ligand domain (gli4ser) 4, followed by an SSS mutant joint and FC duplicate domain P238S-P331S fused to one NLG ligand domain and followed by a C-terminal of the allele-wild RNAse domain (SEQ ID NO: 65-66).
[0264] RSLV-128 is a multiple nuclease fusion construct that incorporates an amino terminal of the human allele-wild RNase domain, fused to a ligand domain (gli4ser) 4, followed by an SSS mutant joint and a double mutation FC domain P238S-P331S fused to an NLG linker domain and followed by a C-terminus of the mutant DNase domain (G105R / A114F) (SEQ ID NO: 67-68).
[0265] RSLV-129 is a multispecific fusion construct that incorporates a human terminal allele-wild amino RNase domain, fused to a SSS mutant joint and a P238S-P331S double mutant Fc domain fused to the NLG ligand domain and followed by a NLG ligand domain of C-terminal mutant DNase (G105R / A114F) (SEQ ID NO: 69-70).
[0266] RSLV-132 incorporates an allele-wild RNase cassette fused directly to a SCC version of the human IgG1 joint, and a P238S, P331S mutant human IgG1 Fc domain (SEQ ID NOs: 91-92 E 95-96).
[0267] RSLV-133 is a multispecific fusion construct that incorporates a human terminal allele-wild amino RNase domain, fused to a SCC mutant joint and a P238S-P331S double mutant Fc domain fused to the NLG ligand domain and followed by a NLG ligand domain C-terminal mutant DNase (G105R / A114F) (SEQ ID NO: 93-94 AND 97-98).
[0268] Additional versions of RSLV-125-RSLV-129 with an SCC joint are shown in Table 1 as RSLV-125-2 (SEQ ID NO: 77-78), RSLV-126-2 (SEQ ID NO: 79- 80), RSLV-127-2 (SEQ ID NO: 81-82), RSLV-128-2 (SEQ ID NO: 83-84), and RSLV-129-2 (SEQ ID NO: 85-86). 0: Western Blot on RSLV 125-129 fusion proteins expressed from COS7 transfections
[0269] Figure 9 shows a Western Blot on COS transfection supernatants from RSLV 125-129 constructs. Expression plasmids containing RSLV 125, 126, 127, 128, or 129 were transfected into COS7 cells using Polyfect transfection reagent and supernatants collected after 48 hours. In addition, the simple nuclease molecules contained in RSLV 125 and 126, plus complexes of multi-nuclease fusion proteins were also expressed from the transient transfections of COS cells, encoded by RSLV 127, 128, and 129. Western analysis blotting was performed on supernatants from transient transfectants. The molecules shown in figure 9 contain human RNase 1 fused to the human SSS IgG1 joint, and IgG G1 P238S-P331S Fc domain, or include human RNase (wild allele) fused to the F2 CH2-CH3 Domain SSS- (P238S-331S ) of human IgG1, followed by a new ligand containing an N-linked glycosylation site to protect the protease cleavage ligand domain, and the G105R-A114F mutant allele formed from human DNase1 in the carboxy terminal of the molecule. In addition, RSLV 127 encodes the above human DNase 1 mutant at the amino terminus and RNase 1 WT at the carboxy terminus of the -Ig mutant tail. The COS supernatants were collected after 72 hours and 0.5 ml samples were immunoprecipitated overnight at 4 ° C with 100 µl protein A-agarose beads. The protein A beads were centrifuged and washed twice in PBS before resuspension in buffer loaded with SDS-PAGE, to reduce NuPAGE gel or not to reduce the LDS sample buffer (Invitrogen, Carlsbad, CA). The samples were heated according to the manufacturer's instructions, the protein A beads were centrifuged to pelletize, and the sample buffer loaded on 5-12% NuPAGE gradient gel. The samples were electrophoresed at 150 volts for 1.5-2 hours, and the gels were blotted on nitrocellulose membranes at 30 mamp for 1 hour. The Western blot was blocked in TBS / 5% non-whole milk overnight. The blots were incubated with 1: 2500 HRP (wild radish peroxidase) conjugated to goat anti-human IgG (specific Fc, Jackson Immunoresearch) for 1.5 hours at room temperature, washed in PBS / 0.5% Tween 20 five or more, and blots developed using ECL reagent. The results demonstrate that the construction of the Fc nuclease fusion proteins was a success and that the proteins are easily expressed in COS cells. In addition, the reduction and non-reduction profile analysis for these Fc nuclease fusion proteins confirms that the DNA constructs encode proteins of appropriate molecular weight. The non-reduction SDS-PAGE pattern confirms that the protein's disulfide binding properties are consistent with the expected behavior of the constructs. 1: SRED analysis of the affinity of purified proteins from COS7 transfectants
[0270] Figure 10 shows the SRED analysis comparing the aliquots of purified proteins of proteins A, from COS supernatants transfected with RSLV of 0. A 2% agarose gel was prepared with distilled water. Poly-IC (Sigma) was dissolved in distilled water at 3 mg / ml. The gel plate was prepared as follows: 1.5 ml of reaction buffer (0.2M Tris-HCl, pH 7.0, 40mM EDTA and 0.1 mg / ml ethidium bromide), 1 ml of Poly- IC and 0.5 ml of water were placed in a tube and kept at 50 ° C for 5 minutes. 3 ml of agarose (maintained at 50 ° C) was added to the tube. The mixture was immediately poured onto a glass plate. The sample wells were drilled into the gel. 2μl of each control, serum sample, or similar purified RSLV proteins, was loaded into the wells and the gel was incubated at 37 ° C for 4 hours and in a humid chamber. Then, the gel was incubated in a buffer (20 mM sodium acetate, pH 5.2, 20 mg / m ethidium bromide) on ice for 30 minutes, and read under UV. The gels were photographed on a UV transilluminator using a Kodak DC290 digital camera system, equipped with ethidium bromide filters and analyzed using “Kodak Molecular Imaging” image analysis software. The results of the analysis of the enzymatic activity of RNase indicate that all constructs contain catalytically active RNase portions. 2: DNase gel activity of RSLV nuclease molecules.
[0271] Figure 11 illustrates the results from the analysis of DNase nuclease activity performed on purified protein A protein from COS7 supernatants transfected with RSLV fusion plasmids 0. Figure 11 five panels (11a, 11b, 11c ), with each panel gel shown the digestion pattern with decreased amounts of the indicated fusion protein and 1 microgram of plasmid DNA. Each protein was serially diluted in two increments in water-free nucleases from 500 ng to 4 ng of the enzyme. For each sample, 1 µg of PDG plasmid DNA was added, incubated for 30 minutes at 37 degrees. Half of each sample was subjected to agarose gel electrophoresis for 30 minutes at 10 volts using 1.2% TAE agarose gel. Figure 11c illustrates the results of an analysis of DNAse enzyme activity in gel using commercially available DNAse 1 (Biolabs, Inc.). The column farthest to the right is a negative control with DNA alone and no enzyme, the column to the left of that is another negative control, that is, an RNase-Ig molecule that has RNase activity, but no DNase activity, as expected in the remaining intact plasmid DNA and is not digested in both cases. The results demonstrate that the commercially available DNase 1 enzyme is highly active and digests all DNA at most concentrations tested. The results in figures 11a and 11b illustrate the DNAase activity of four different nuclease Fc fusion constructs. The top panel in figure 11a shows the ability of a DNase-Ig fusion protein to digest plasmid DNA, as is apparent from the gel, this enzyme digests all DNA at all concentrations tested is as active, or more active than than DNase 1 commercially available. In the lower panel of figure 11 a is a bispecific Fc protein of bispecific fusion with DNase at the amino terminus of Fc (SEQ ID NOs: 65-66) and it also has DNAse enzyme activity, but slightly less than DNase- Ig on the top panel of Figure 11a. The upper panel of figure 11b shows the enzymatic activity of DNase from another bispecific nuclease, this Fc fusion protein has DNase on the C-terminal of the Fc connected to the Fc via a specially engineered NLG ligand (SEQ ID NOs: 67-68) . As is apparent from the data on this enzyme it also has a robust DNase enzyme activity and appears to be more active than the other bispecific nucleases examined here. The bottom panel of figure 11b shows the DNase enzyme activity of another bispecific nuclease molecule that is lost (G4S) 4 ligand connecting the RNase module with the Fc (SEQ ID NO: 69-70). This bispecific nuclease also has good DNase activity but appears to be somewhat smaller than the other bispecific Fc nuclease fusion proteins shown in this experiment. These data suggest that all bispecific nucleases have good DNase activity, which is an unexpected finding from past efforts in other experiments in this direction (Dwyer et al., “JBC”, volume 271, No. 14; pp 97389743). In addition, the position of DNase in the construct, as well as the length of the ligand and composition connecting DNase to Fc are critical in creating a highly active DNase enzyme in the context of a bispecific nuclease Fc Fusion protein. 3: analysis of enzyme kinetics
[0272] Figures 12-13 show the results from the analysis of the kinetic fluorescent enzyme activity compared to the activity of the recombinant RNase A RNase (Ambion), RSLV 125, RSLV 126, nRNase WT-SCCH-WThIGG1, and hRNaseG88D- SCCH- (P238S / K322S / P331S) hIgG1. To further define the functional characteristics of the bivalent mRNase-Ig fusion protein, we studied the enzyme kinetics of different nuclease fusion proteins using the substrate Rnase Alert (Ambion / IDT) and fluorescence was quantified with a Biotek Synergy2 microplate reader . The data was analyzed using Gen5 software (Biotek Instruments, Inc., Winooski, Vermont). The relative fluorescence units as a function of time were evaluated every minute during the course of a 45-minute experiment, incubated at 37 ° C according to the manufacturer's instructions, using the decrease in the onset of enzyme concentrations from 10 pg / ul and serial dilution to 0.1 pg / ul in 0.67x increments. Each sample included a fixed concentration of the Rnase Alert substrate (200nM) in a 1X Rnase Alert reaction buffer.
[0273] Figure 12 shows the RFU (relative fluorescence units) versus time for each protein in equimolar concentrations, with the test proteins at 4.5 pg / ul or 4.5ng / ml, and the recombinant RNAse A control at 1.3 pg / ul in the presence of 200 nM of RNase Alert substrate.
[0274] Figure 13 shows a Lineweaver Burk plot of the different molecules. In order to estimate the Vmax and Km, the RNase Alert kinetic fluorescence analysis was represented using 105 pM of the enzyme, and the substrate concentration was decreased from 200 nM to 50 pM in four times the increment. Thus, the concentration of the enzyme was fixed and the concentration of the substrate was titrated in this series of experiments. The data showed that the Lineweaver Burk plots for the different fusion proteins under these conditions. Taken together, the data in figures 12 and 13 demonstrate that the RNase moieties are highly active in the three RNAse Fc fusion proteins constructed and tested here. 4: Evaluation of cytotoxicity in vitro against the human THP-1 cell line.
[0275] Figures 14-15 show the results of in vitro analysis studies of the effects of RNaseIg fusion proteins with wild or mutant allele (including SCC, P238S, P331S) -IgG Fc domains on the survivors of a human monocytic cell line , THP1. THP1 cells were maintained in logarithmic growth in RPMI / 10% FBS before collection for analysis. The cells were greater than 98% viable before use in the cytotoxicity assessment. THP1 cells were plated in 96-well plates at a cell density of 1x10e6 w / ml, or 100,000 cells per well. The hybrid nuclease proteins were added to the successive wells using a serial dilution in two series starting at 5 micrograms / ml and ending with 0.01 microgram / ml of the fusion protein per reaction. In this experiment, an RNase-Fc fusion protein with an allele-wild IgG1 Fc (wtRNasewtIgG) was compared with an RNase-Fc with an Fc mutant (P238s, P331S) that had a significantly reduced Fc receptor on binding and interalization (mtRNasemgIgG), regarding its ability to induce cytotoxicity in cultured THP1 cells. The reactions were incubated in the 96-well plates for three days at 37 ° C, 5% CO2 before cell collection and analysis. After three days, the cells were harvested by centrifugation at 1000 rpm, washed in PBS / 2% FBS, and incubated with the FITC Annexin V detection and apoptosis kit reagents (# 556547, Becton Dickinson / Pharmingen), according to the manufacturer's instructions. The cells were washed with 100 microliters of cold binding buffer supplied with the kit, and Annexin V-FITC / Propidium (PI) iodide added in 1: 100 in 100 µl of the binding buffer. The samples were incubated on ice for 20 minutes, after which 400 μl of additional binding buffer was added to each sample. The stained samples were analyzed by flow cytometry using a FACS Canto (Becton Dickinson) and the data analyzed using the Flowjo software (Treestar, Ashland, OR).
[0276] Figure 14 showed the effect of RNase Fc proteins fusing with the wild allele or the mutant Fc domain on dead cells as measured by two methods, Annexin V binding (top panel) and propidium iodide binding ( bottom panel), both are sensitive measures of dead cells. This experiment demonstrates that the binding of the RNase fusion protein to mutant Fc (P238S, P331S) has reduced binding to Fc receptors on the surface of THP1 cells, and subsequent internalization of the protein. The results demonstrate a significant decrease in cell death by the RNase-Fc mutant compared to the allele-wild-type Fc RNase fusion proteins (for example, a decrease of approximately 3 times by 1.25 μ g / ml of the protein). Figure 15 shows the results of the activated fluorescence cell classification (FACS) experiments to examine the cytotoxicity of the RNase Fc fusion constructs with a wild-type allele or the mutant Fc domain (RNAse-wtIgG or RNase-mtIgG, respectively). The data demonstrate a significant decrease in the number of dead cells when THP1 cells are incubated with the RNase Fc construct with a mutant Fc (smaller peak to the right of the graph for the RNase Fc mutant compared to RNase-wtIgG). These data show an approximately 3- to 5- fold decrease in cell death by the RNase Fc mutant compared to the allele-wild. These and other experiments examining the binding of the Fc receptor clearly showed that in the presence of cells supporting Fc receptors to the RNase Fc construct with an altered Fc region it has reduced binding to Fc receptors and less internalization by the cell, resulting in less cell death due to activity RNase of the construct. Said constructs are particularly useful in the treatment of autoimmune diseases as it may be undesirable to use a therapeutic protein that is cytotoxic to the cells supporting the Fc receptor. 5: IFN-alpha production by human PBMCs is inhibited by the addition of RSLV-132 for in vivo cultures.
[0277] The addition of RSLV132 abolished the induction of interferon-alpha from stimulated human peripheral blood mononuclear cells, using immune complexes primed with serum from three SLE patients plus necrotic cell extract (NCE) (Figure 16). To measure the ability of RSLV-132 to bind to and degrade the RNA contained in the immune complexes of patients with lupus, an in vitro bioanalysis was developed. The experiment involves the formation of immune complexes in vitro using autoantibodies from patients with lupus and NCE from cultured human cells (U937). The combination of serum from lupus patients with NCE results in the formation of immune complexes (IC) that are very potent inducers of interferon, normal human serum does not stimulate interferon production. The CI is incubated with normal human peripheral blood mononuclear cells (PBMC’s) as reporter cells. The production of interferon by the reporter cell is measured using an interferon-alpha ELISA. Reporter cells were obtained from normal volunteers by Ficoll density gradient centrifugation. The lupus patient or healthy normal volunteer serum was obtained from the University of Washington Institutional Review Board #HSD No. 3971, the serum was diluted 1/1000 and added to 10% (v / v) of necrotic cell extract (NCE ) derived from U937 cells cultured as above. The serum from the lupus patient and the normal volunteer was incubated with the NCE for 15 minutes at room temperature, the resulting CIs were incubated with or without various doses of RSLV-132, RSLV-124, or allele-wild RNase for 15 minutes then incubated with normal PBCMs for 20 hours in the presence of 500 U / ml Universal IFN followed by measuring the amount of IFN secreted from the PBMC culture. The serum was obtained from three (3) different lupus patients with varying degrees of disease activity ranging from medium to active. The NCE was incubated with both the lupus patient's serum and the serum of normal healthy volunteers at room temperature for 15 minutes, followed by 20 hours of incubation with PBMCs. IFN-α has been quantified by ELISA where IFN-α is captured using a mouse MAb against human alpha IFN (MMHA-11) [PBL Biomedical Laboratories, product # 2112-1] and has been detected using a rabbit polyclonal antibody against Alpha IFN [PBL Biomedical Laboratories, product # 31101-1], followed by development using anti-rabbit HRP {Jackson Immuno Research, product # 711-035-152] and TMB substrate. In some cases prior to the addition of NCE to PBMCs, the test article (RSLV-124 or RSLV-132) was added in concentrations of 0.16, 0.5; 1.6 and 5.0 ug / mL or RNase was added in concentrations of 0.05; 0.16; 0.5 and 1.6 ug / mL (equimolar) for the NCE. The ability of the lupus patient's serum to stimulate IFN production and IFN from PBMCs was reduced by approximately 50% with the addition of 5.0 µg / mL RSLV-124. This inhibition reflects the equimolar amount of RNase. The addition of the same concentration of huRSLV-132 was as or more efficient in inhibiting IFN than RSLV-124, with IFN production almost completely abolished with the addition of 5.0 µg / ml of hURSLV-132. When combined with NCE, the anti-RNA / DNA antibodies of the lupus patient are bridging inducers of IFN from fresh isolated PBMCs. Serum from normal volunteers does not have the same ability to stimulate IFN production from reporter cells. This data indicates that the autoantibodies circulating in the patient's lupus serum are capable of forming immune complexes that presumably arouse TLR7 and the subsequent production and IFN. The exact type and subtypes of IFN were not analyzed. This data indicates that RSLV-132 bind to its molecular targets, the RNA associated with the lupus patient's CIs, and potentially degrade, thereby preventing IFN stimulation from PBMCs (Figure 16). RSLV-132 appears to be more active than RSLV-124 in this assessment. 6: RSLV-132 is a potent in vivo inhibitor of RNA-inducing Interferon activation.
[0278] To assess the ability of RSLV-132 to bind to and degrade RNA in the mouse circulation, a pharmacodynamic model was developed using a mimetic polyinosinic: polycytidyl acid (poly I: C) which is a robust activator of the interferon pathway . Poly (I: C) is a double-stranded RN not combined with a strand being a polymer of inosinic acid, the other is a polymer of cytidyl acid. It is known to interact with the type 3 Toll receptor (TLR3) that is expressed in the membrane of B cells, macrophages and dendritic cells. Poly (I: C) is available from Invitrogen. The effects of poly I: C can be quantified by measuring the levels of expression of genes stimulated by interferon in the spleen of mice following administration. On day zero 10 B6 mice, three months old, were treated with either RSLV-132 (250 µg per mouse) or intravenous immunoglobulin (IVIG) (Privigen, Behring) (250 µg per mouse) as a control, both via intraperitoneal injection. Twenty hours after the injection of RSLV-132 or IVIG, the poly (I: C) was injected into the mice at 200ug per mouse, intraperitoneally. Two hours later, the animals were sacrificed for exposure to CO2, the spleens were collected in RNAlater (Qiagen) and stored at -80 ° C for further study of the expression of genes stimulated by interferon (ISGs). The spleen samples were submitted to the study of the expression of ISGs, including Ifit1 (interferon-induced protein with repeated tetratricopeptide 1 (UniProt Q64282)), Irf7 (interferon regulating factor 7 (UniProt P70434)) and the Mx1 gene by qPCR. The results of these experiments demonstrate that the intraperitoneal injection of RSLV-132 results in concentrations in the RSLV-132 serum that are able to bind to the circulating poly (I: C) and effectively degrade the mimetic RNA, effectively thus preventing the stimulation of the route interferon and the three monitored ISGs (Figure 17). 7: Analysis of the enzyme kinetics for RSLV-132 and RSLV-133.
[0279] RSLV-132 and RSLV-133 were transiently expressed in CHO cells and purified using protein-A. The RNAse activity of these RNase Fc fusion proteins was quantified using the RNaseAlert QC kit (Cat # AM1966). Various amounts of the RNase Fc fusion protein have been used and the results are shown in figure 18 in relation to the relative fluorescence units (RFUs) over time. The results demonstrate that RSLV-132 is a highly active RNase enzyme, and has increased RNase activity compared to other RNase Fc fusion constructs such as RSLV-124 and the wild-type RNas allele, for example, using equal amounts (400 pM ) of RSLV-132 and RSLV-124 resulting in more than twice the RFUs (80,000 versus 35,000) for RSLV-132 vs. RSLV-124. In addition, two batches of the productions were tested for stability at 4C. RSLV-132.1 was stored at 4 ° C for 8 weeks before this experiment and RSLV-132.2 was stored at -80 ° C and thawed just before testing, demonstrating that the protein is stable at 4 ° C for up to 2 months. Drug stability and increased catalytic activity can provide increased efficacy in a therapeutic arrangement.
[0280] Figure 19 shows the enzymatic activity of RNAse in RFUs in relation to time, comparing the amount of the RNAse activity of the bispecific RSLV-133 molecule with the mono-specific RSLV-132, and the allele-wild RNAse. As shown in figure 19, the RSLV-133 molecule has significantly increased RNAse activity compared to the mono-specific RSLV-124 molecule or, an early bispecific Fc nuclease, RSLV-123, or allele-wild RNase, resulting in more than 2 times o RFUs with an equal amount of the protein. Figure 20 shows the result of an evaluation of the enzyme activity of DNase of the RLSV-133 molecule in comparison with RSLV-123, a previous bispecific nuclease construct, and allele-wild DNase. In this experiment, the enzymatic activity of DNase was quantified using the DNaseAlert kit from integrated DNA technologies, cleavage of the DNA substrate resulting in a fluorescence emission that was quantified using a Synergy2 multi-plate microplate reader (BioTek Instruments, Inc., Winooski, VT). Figure 20 shows the RFUs of DNase enzyme activity over time for RSLV-133, RSLV-123, or allele-wild DNase. The results of the experiment demonstrate that RSLV-133 has increased DNase activity compared to allele-wild DNase and RSLV-123, the previous bispecific nuclease molecule, resulting in more than 3 times the DNase activity in the linear range of the experiment. Figure 21 demonstrates the ability of the RSLV-133 molecule to digest DNA in a gel digestion experiment. The results show that RSLV-133 is able to digest DNA in this analysis as effectively as allele-wild DNase (compare columns 5 & 7). Given the relative molecular weights of RSLV-133 and allele-wild DNase it appears that RSLV-133 is more effective in digesting DNA in this analysis as well. 8: RSLV-132 demonstrates the impaired Fc receptor binding.
[0281] To examine the ability of Fc RNAse fusion proteins to bind Fc receptors in vitro, RSLV124 (Fc allele-wild domain) and RSLV-132 (mutant Fc domain, P238S / P331S) were incubated with a human myeloid cell line of support Fc, THP1 and specific binding for cells was quantified by analyzing the fluorescence-activated cell stock (FACS). RLSV-124 and RSLV-132 were fluorescently labeled using Alexa fluorine dye AF-647 from Invitrogen (Cat # A20006). After dialysis of the RNase Fc fusion proteins to remove unbound dye, varying the amounts of the labeled proteins were incubated with THP1 cells for one hour, the cells were strictly washed to remove the unbound RNase Fc fusion protein, and the protein specifically bound was quantified by measuring the intensity of the FACS fluorescence. The results in figure 22 demonstrate that the RSLV-132 protein that has a mutant Fc domain has significantly less Fc receptor binding than RSLV-124 that has an allele-wild Fc domain, showing more than 4-fold reduction in binding of the Fc receiver. This finding is consistent with our previous findings that RNase Fc fusion proteins with a mutant Fc domain (P238S / P331S) have significantly decreased cytotoxicity. 9: In vitro analysis of the biological activity of the hybrid nuclease molecule.
[0282] One or more hybrid nuclease molecules are purified, for example, by affinity or ion exchange chromatography as previously described in the examples above. In some examples, the hybrid nuclease molecule is a polypeptide. In some examples, the hybrid nuclease molecule includes one or more of the sequences in Table 1. In some examples, the hybrid nuclease molecule includes a nuclease domain linked to a mutant Fc domain. In some examples, the hybrid nuclease molecule includes a mutant Fc domain. In some examples, the mutant Fc domain comprises mutations in the joint, CH2, and / or CH3 domains. In some examples, the mutant Fc domain comprises P238S and / or P331S, and can include mutations in one or more of the three cysteine joints. In some examples, the mutant Fc domain comprises P238S and / or P331S, and / or mutations in the three cysteine joints for SSS. In some examples the mutant Fc domain comprises P238S and P331S and mutations in the three joints for cysteine. In some examples, the mutant Fc domain comprises P238S and P331S and SSS. In some examples, the mutant Fc domain is shown in SEQ ID NOs: 59, 60, 61. In some embodiments, the hybrid nuclease molecule is shown in SEQ ID. Various linker domains (for example, those described here), can be used to link the Fc domains to the nuclease domains. For example, linker domains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more amino acids in length can be used. The molecules are analyzed for specific nuclease activity in vitro using qualitative analyzes to verify that they have the desired nuclease function. Specific activities are then generally determined by flowering based on kinetic analysis using substrates, such as the RNase or DNase Alert reagent kit, and a fluorescent plate reader arranged to take readings as a function of time. In addition, protein solutions are generally checked for endotoxin contamination using a commercially available kit, such as the “Pyrotell Limulus amebocyte Lysate (LAL)” kit, 0.06 EU / ml of Cape Cod's detection limit, Inc., (E. Palmouth, MA0. The molecules are then evaluated using a variety of in vitro analysis for biological activity.
[0283] A series of in vitro analyzes will measure the effects of molecules on cytokine production by human PBMC in response to various stimuli, in the presence or absence of the molecules in the culture. The human or normal PBMC patient (approximately 1x10 and 6 cells) was cultured for 24, 48, or 96 hours depending on the analysis. PBMCs are cultured in the presence of stimulus such as TLR ligands, costimulatory antibodies, immune complexes, and normal or autoimmune serum. The effects of molecules on cytokine production are measured using commercially available reagents, such as the Biolegend antibody pair kit (San Diego, CA) for IL-6, IL-8, IL-10, IL-4, IFN gamma, TNF-alpha. Culture supernatants obtained from in vitro cultures collected in 24, 48 hours or later, to determine the effects of molecules on cytokine production. IFN-alpha production is measured using, for example, anti-human IFN-alpha antibodies and standard curve reagents available from the PBL interferon source (Piscataway, NJ). A similar set of analysis is performed using the subpopulation of human lymphocytes (isolated from monocytes, B cells, pDCs, T cells, etc.); purified using, for example, commercially available magnetic beads based on Miltenyi Biotech insulation kits (Auburn, CA).
[0284] In addition, the effect of the molecules on the expression of lymphocyte activation receptors such as CD5, CD23, CD69, CD80, CD86 and CD25 are analyzed at various times after the stimulus. The PBMC or the isolated cell subpopulation is subjected to multicolored flow cytometry to determine how these molecules affect the expression of different receptors associated with immune cell activation.
[0285] Another set of tests will measure the effects of these molecules on the proliferation of different subpopulations of lymphocytes in vitro. These analyzes will use, for example, CFDA-SE staining (Invitrogen, Carlsbad, CA) of human PBMC’s prior to stimulation. 5 mM CFSE is diluted 1: 3000 in PBS / 0.5% BSA with 10e7-10e8 PBMCS or subsets of purified cells and labeling reactions incubated for 3-4 minutes at 37 ° C before several RPMI wash periods / 10% FBS to remove the remaining CFSE. The labeled CFSE cells are then incubated in co-culture reactions with various stimuli (TLR ligands, costimulatory antibodies, etc.) and the molecules for 4 days before analyzing cell proliferation by flow cytometry using specific subpopulation antibodies cell conjugated to dye.
[0286] Another analysis will measure the cytotoxicity of one or more molecules. This analysis will mediate toxicity using the Annexin 5 stain (for example, Annexin 5-FITC). The cells of interest (for example, monocytes or a monocytic cell line) are contacted with a hybrid nuclease molecule of interest (for example, a hybrid nuclease molecule having a mutant Fc domain) or one or more controls. At various times after contact, the cells are separated from the culture and stained with Annexin 5. The number of apoptotic or dead cells is then counted, for example, using flow cytometry or fluorescent microscopy. Cells contacted with a hybrid nuclease molecule of interest show fewer numbers of cells staining positive for Annexin 5 compared to positive controls.
[0287] The effects of these molecules on the in vitro maturation of monocytes in DCs and macrophages are also assessed using both normal samples and samples from PBMC patients.
[0288] The effectiveness of a hybrid nuclease molecule is demonstrated by comparing the results of an analysis of the cells treated with a hybrid nuclease molecule described here with the results of the analysis of cells treated with control formulations. After treatment, the levels of various markers (eg, cytokines, cell surface receptors, proliferation) described above are generally improved in an effective group of treated molecules in relation to the levels of markers existing before treatment, or in relation to levels measured in a control group. Example 20: Administration of a hybrid nuclease molecule to a mammal in need of it.
[0289] Mammals (eg mice, rats, rodents, humans, guinea pigs) are used in the study. Mammals are administered (for example, intravenously) one or more hybrid nuclease molecules comprising one or more sequences from Table 1 or a control. In some examples, the hybrid nuclease molecule is a polypeptide. In some examples, the hybrid nuclease molecule includes one or more sequences from Table 1. In some examples, the hybrid nuclease molecule includes a nuclease domain linked to a mutant Fc domain. In some examples, the hybrid nuclease molecule includes a mutant Fc domain. In some instances, the mutant Fc domain comprises mutations in the joint, CH2, and / or CH3 domains. In some examples, the mutant Fc domain comprises P238S and / or P331S, and may include mutations in one or more of the three cysteine joints. In some examples, the mutant Fc domain comprises P238s and / or P331S, and / or mutations in the three cysteine joints. In some examples, the mutant Fc domain comprises P238s and / or P331S, and / or mutations in the three cysteine joints for SSS. In some examples, the mutant Fc domain comprises P238s and P331S and mutations in the three cysteine joints. In some examples, the mutant Fc domain comprises P238S and P231S and SSS. In some examples, the mutant Fc domain is shown in SEQ ID NOS: 59, 60, 61. In some examples, the hybrid nuclease molecule is shown in SEQ ID NOS. Various linker domains (for example, those described here) can be used to link the Fc domains to the nuclease domains. For example, the binding domains: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more long amino acids can be used, In some examples, the hybrid nuclease molecule is formulated as a pharmaceutically acceptable carrier. In some examples, the molecule is formulated as described in the pharmaceutical compositions in the section above. The hybrid nuclease molecule targets RNase and / or DNase.
[0290] Multiple rounds of doses are used when considered useful. The effects on IFN-alpha levels, IFN-alpha response gene levels, autoantibody titration, renal function and pathology, and / or circulatory immune complex levels are monitored in mammals. Similar studies are carried out with different treatment protocols and routes of administration (for example, intramuscular administration, etc.). The effectiveness of a hybrid nuclease molecule is demonstrated by comparing IFN-alpha levels, IFN-alpha response gene levels, autoantibody titration, renal function and pathology, and / or circulating immune complex levels in mammals treated with a hybrid nuclease molecule described herein for treating mammals with control formulations.
[0291] In one example, a human individual in need of treatment was selected or identified. The individual may be in need of, for example, reducing the cause or symptom of SLE. The identification of the individual can occur in a clinical direction, or otherwise, for example, in the individual's home through the individual's own use of the self-test kit.
[0292] At time zero, an appropriate first dose of a hybrid nuclease molecule is administered to the individual. The hybrid nuclease molecule is formulated as described here. After the period of time, after the first dose, for example, 7 days, 14 days, and 21 days, the individual's condition is assessed, for example, by measuring the levels of IFN-alpha, the levels of the response gene of IFN-alpha, autoantibody titration, renal function and pathology, and / or circulating immune complex levels. Other relevant criteria can also be measured. The number and extent of doses are adjusted according to the individual's needs.
[0293] After treatment, the individual's IFN-alpha levels, IFN-alpha response gene levels, autoantibody titration, renal function and pathology, and / or circulating immune complex levels they are decreased and / or improved in relation to the levels existing before the treatment, or in relation to the levels measured in a similarly afflicted but untreated individual / control individual.
[0294] In another example, an individual rodent in need of treatment is selected or identified. The identification of the individual may take place in a laboratory setting or otherwise.
[0295] At time zero, an appropriate first dose of a hybrid nuclease molecule is administered to the individual. The hybrid nuclease molecule is formulated as described here. After a period of time, then the first dose, for example, 7 days, 14 days, and 21 days, the condition of the individual was assessed, for example, by measuring the levels of IFN-alpha, the levels of the gene of response of IFN-alpha, autoantibody titration, renal function and pathology, and / or circulating immune complex levels. Other relevant criteria can also be measured. The number and extent of doses are adjusted according to the individual's needs.
[0296] After treatment, the individual's IFN-alpha levels, IFN-alpha response gene levels, autoantibody titration, renal function and pathology, and / or circulating immune complex levels they are decreased and / or improved in relation to the levels existing before the treatment, or in relation to the levels measured in a similarly afflicted individual, but an untreated individual / control individual.
[0297] Although the invention has been particularly illustrated and described with reference to a preferred embodiment and several alternative embodiments, it should be understood by those skilled in the art that various changes in form and details can be made here, without escaping the spirit and spirit of protection scope of the invention.
[0298] All references, patents granted and patent applications cited, within the body of this specification are hereby incorporated by reference in their entirety, and for all purposes.

权利要求:
Claims (31)
[0001]
1. Polypeptide, characterized by the fact that it comprises a human RNAse and a mutant human IgG1 Fc domain, the human RNAse being operably linked to the Fc domain and the Fc domain includes a P238S mutation and a P331S mutation, and the polypeptide comprises: an amino acid sequence represented in SEQ ID Nos: 96, 92, 62 or 78; or an amino acid sequence represented in SEQ ID NO: 98 or 94.
[0002]
2. Polypeptide according to claim 1, characterized in that it comprises the polypeptide comprising the amino acid sequence represented in SEQ ID NO: 96.
[0003]
3. Polypeptide according to claim 1, characterized in that the peptide comprises an amino acid sequence represented in SEQ ID NO: 98.
[0004]
4. Dimer, characterized in that it comprises a polypeptide, as defined in any one of claims 1 to 3, optionally a homodimer.
[0005]
5. Composition, characterized by the fact that it comprises the polypeptide, as defined in any one of claims 1 to 3, or the dimer of claim 4, and a pharmaceutically acceptable carrier.
[0006]
6. Nucleic acid molecule, characterized by the fact that the nucleic acid molecule encodes the polypeptide, as defined in any one of claims 1 to 3.
[0007]
7. Recombinant expression vector, characterized by the fact that the vector comprises a nucleic acid molecule, as defined in claim 6.
[0008]
8. Microbial host cell, characterized by the fact that it is transformed by the recombinant expression vector, as defined in claim 7.
[0009]
9. Method for preparing the polypeptide, as defined in any one of claims 1 to 3, characterized in that it comprises: providing a host cell containing a nucleic acid sequence encoding the polypeptide; and maintaining the host cell in conditions in which the polypeptide is expressed.
[0010]
10. Polypeptide according to any one of claims 1 to 3, characterized by the fact that it is aimed at the manufacture of a medicament to treat or prevent a condition associated with the excessive release of (ribo) nucleprotein.
[0011]
11. Dimer, according to claim 4, characterized by the fact that it is aimed at the manufacture of a drug to treat or prevent a condition associated with the excessive release of (ribo) nucleoprotein.
[0012]
12. 10. Composition, according to claim 5, characterized by the fact that it is aimed at the manufacture of a medicine to treat or prevent a condition associated with the excessive release of (ribo) nucleoprotein.
[0013]
13. Polypeptide, according to claim 10, characterized by the fact that the condition is an autoimmune disease, associated with the excessive release of (ribo) nucleoprotein.
[0014]
14. Dimer according to claim 11, characterized in that the condition is an autoimmune disease associated with the excessive release of (ribo) nucleoprotein.
[0015]
15. Use of the composition according to claim 12, characterized by the fact that the condition is an autoimmune disease associated with the excessive release of (ribo) nucleoprotein.
[0016]
16. Polypeptide according to claim 13, characterized in that the autoimmune disease is SLE.
[0017]
17. Dimer according to claim 14, characterized by the fact that the autoimmune disease is SLE.
[0018]
18. Composition according to claim 15, characterized by the fact that the autoimmune disease is SLE.
[0019]
19. Polypeptide according to claim 13, characterized in that the autoimmune disease is Sjogren's syndrome.
[0020]
20. Dimer according to claim 14, characterized by the fact that the autoimmune disease is Sjogren's syndrome.
[0021]
21. Composition according to claim 15, characterized by the fact that the autoimmune disease is Sjogren's syndrome.
[0022]
22. Polypeptide according to claim 13, characterized in that the autoimmune disease is lupus nephritis.
[0023]
23. Dimer according to claim 14, characterized by the fact that the autoimmune disease is lupus nephritis.
[0024]
24. Composition according to claim 15, characterized by the fact that the autoimmune disease is lupus nephritis.
[0025]
25. Nucleasse-containing composition, characterized by the fact that it is aimed at the manufacture of an effective drug to degrade immune complexes containing RNA, DNA or both, RNA and DNA, the composition comprising a pharmaceutically acceptable carrier and the polypeptide of claim 1, comprising an amino acid sequence represented in SEQ ID NOs: 96, 98, 92, 94, 62, or 78, and for use in the treatment of SLE.
[0026]
26. Polypeptide, according to claim 2, characterized by the fact that it is directed to the manufacture of a medication for the treatment of SLE.
[0027]
27. Polypeptide, according to claim 4, characterized by the fact that it is directed to the manufacture of a medication for the treatment of SLE.
[0028]
28. Polypeptide according to any one of claims 1 to 3, characterized in that the polypeptide is formulated for intravenous administration.
[0029]
29. Dimer according to claim 4, characterized in that the dimer is formulated for intravenous administration.
[0030]
30. Composition according to claim 5, characterized in that it is formulated for intravenous administration.
[0031]
31. Nuclease-containing composition according to claim 25, characterized in that it is formulated for intravenous administration.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112013027547B1|2021-01-19|polypeptide, dimer, composition, nucleic acid molecule, recombinant expression vector, microbial host cell, method for preparing the polypeptide and composition containing nucleasse

---

AU2018201071B2|2020-01-23|Therapeutic nuclease compositions and methods

同族专利:

---

公开号 | 公开日

---

JP2014519809A|2014-08-21|

---

JP2020203926A|2020-12-24|

---

AU2012249360B2|2015-12-24|

---

AU2016201790A1|2016-04-14|

---

AU2012249360A1|2013-04-11|

---

CN103930127A|2014-07-16|

---

JP2017114854A|2017-06-29|

---

EP2704737A2|2014-03-12|

---

CN107964539A|2018-04-27|

---

US10000745B2|2018-06-19|

---

AU2020201619A1|2020-03-19|

---

HUE038759T2|2018-11-28|

---

EP2704737A4|2015-07-01|

---

US10202588B2|2019-02-12|

---

JP6762345B2|2020-09-30|

---

DOP2013000250A|2014-01-31|

---

AU2018201073A1|2018-03-08|

---

SG10201913930UA|2020-03-30|

---

PE20141172A1|2014-09-22|

---

NZ616989A|2016-03-31|

---

PL2704737T3|2018-07-31|

---

IL269020A|2021-09-30|

---

US20190119660A1|2019-04-25|

---

CO6811815A2|2013-12-16|

---

AU2018201073B2|2019-12-05|

---

MX351953B|2017-11-06|

---

IL285985D0|2021-10-31|

---

US8937157B2|2015-01-20|

---

WO2012149440A2|2012-11-01|

---

EP2704737B1|2018-01-10|

---

US11034944B2|2021-06-15|

---

ECSP13013060A|2015-03-31|

---

WO2012149440A3|2014-05-15|

---

MX2013012612A|2014-01-24|

---

BR112013027547A2|2016-11-29|

---

CL2013003123A1|2014-08-22|

---

KR102161657B1|2020-10-06|

---

KR102006393B1|2019-08-02|

---

JP6063450B2|2017-01-18|

---

SG194680A1|2013-12-30|

---

HRP20180564T1|2018-06-01|

---

US20140044711A1|2014-02-13|

---

KR20200113028A|2020-10-05|

---

US20150152399A1|2015-06-04|

---

IL269020D0|2019-10-31|

---

CN103930127B|2018-01-09|

---

LT2704737T|2018-06-11|

---

CR20130598A|2014-03-19|

---

ES2666303T3|2018-05-03|

---

US20140178379A1|2014-06-26|

---

US20210395711A1|2021-12-23|

---

DK2704737T3|2018-04-23|

---

JP2019022505A|2019-02-14|

---

KR20190090884A|2019-08-02|

---

AU2016201790B2|2017-11-30|

---

IL229074D0|2013-12-31|

---

SI2704737T1|2018-06-29|

---

CA2834626A1|2012-11-01|

---

EP3449933A1|2019-03-06|

---

AU2018201073C1|2020-06-04|

---

EA201391585A1|2014-04-30|

---

KR20140043353A|2014-04-09|

---

IL229074A|2020-04-30|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US3773919A|1969-10-23|1973-11-20|Du Pont|Polylactide-drug mixtures|

---

US3941763A|1975-03-28|1976-03-02|American Home Products Corporation|PGlu-D-Met-Trp-Ser-Tyr-D-Ala-Leu-Arg-Pro-Gly-NH2 and intermediates|

---

US4263428A|1978-03-24|1981-04-21|The Regents Of The University Of California|Bis-anthracycline nucleic acid function inhibitors and improved method for administering the same|

---

IE52535B1|1981-02-16|1987-12-09|Ici Plc|Continuous release pharmaceutical compositions|

---

EP0088046B1|1982-02-17|1987-12-09|Ciba-Geigy Ag|Lipids in the aqueous phase|

---

US5559212A|1988-04-06|1996-09-24|Alfacell Corporation|Frog embryo and egg-derived tumor cell anti-proliferation protein|

---

HUT35524A|1983-08-02|1985-07-29|Hoechst Ag|Process for preparing pharmaceutical compositions containing regulatory /regulative/ peptides providing for the retarded release of the active substance|

---

EP0143949B1|1983-11-01|1988-10-12|TERUMO KABUSHIKI KAISHA trading as TERUMO CORPORATION|Pharmaceutical composition containing urokinase|

---

US4683202B1|1985-03-28|1990-11-27|Cetus Corp|

---

US4683195B1|1986-01-30|1990-11-27|Cetus Corp|

---

US4800159A|1986-02-07|1989-01-24|Cetus Corporation|Process for amplifying, detecting, and/or cloning nucleic acid sequences|

---

US5453269A|1986-04-14|1995-09-26|The General Hospital Corporation|Heterobifunctional antibodies having dual specificity for fibrin and thrombolylic agents and methods of use|

---

US4965188A|1986-08-22|1990-10-23|Cetus Corporation|Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme|

---

AU600575B2|1987-03-18|1990-08-16|Sb2, Inc.|Altered antibodies|

---

US6780613B1|1988-10-28|2004-08-24|Genentech, Inc.|Growth hormone variants|

---

US5225538A|1989-02-23|1993-07-06|Genentech, Inc.|Lymphocyte homing receptor/immunoglobulin fusion proteins|

---

US5840840A|1990-04-17|1998-11-24|The United States Of America As Represented By The Department Of Health And Human Services|Selective RNase cytotoxic reagents|

---

MX9204374A|1991-07-25|1993-03-01|Idec Pharma Corp|RECOMBINANT ANTIBODY AND METHOD FOR ITS PRODUCTION.|

---

WO1993015722A1|1992-02-07|1993-08-19|Syntex Inc.|Controlled delivery of pharmaceuticals from preformed porous microparticles|

---

GB9300686D0|1993-01-15|1993-03-03|Imp Cancer Res Tech|Compounds for targeting|

---

US5637481A|1993-02-01|1997-06-10|Bristol-Myers Squibb Company|Expression vectors encoding bispecific fusion proteins and methods of producing biologically active bispecific fusion proteins in a mammalian cell|

---

US20030108548A1|1993-06-01|2003-06-12|Bluestone Jeffrey A.|Methods and materials for modulation of the immunosuppressive activity and toxicity of monoclonal antibodies|

---

GB9422383D0|1994-11-05|1995-01-04|Wellcome Found|Antibodies|

---

US6348343B2|1995-02-24|2002-02-19|Genentech, Inc.|Human DNase I variants|

---

US5869046A|1995-04-14|1999-02-09|Genentech, Inc.|Altered polypeptides with increased half-life|

---

US6096871A|1995-04-14|2000-08-01|Genentech, Inc.|Polypeptides altered to contain an epitope from the Fc region of an IgG molecule for increased half-life|

---

US6121022A|1995-04-14|2000-09-19|Genentech, Inc.|Altered polypeptides with increased half-life|

---

US5739277A|1995-04-14|1998-04-14|Genentech Inc.|Altered polypeptides with increased half-life|

---

US5989830A|1995-10-16|1999-11-23|Unilever Patent Holdings Bv|Bifunctional or bivalent antibody fragment analogue|

---

US6482626B2|1996-02-05|2002-11-19|Genentech, Inc.|Human DNase|

---

US6716974B1|1996-05-31|2004-04-06|Maine Medical Center Research Institute|Therapeutic and diagnostic methods and compositions based on jagged/notch proteins and nucleic acids|

---

US6391607B1|1996-06-14|2002-05-21|Genentech, Inc.|Human DNase I hyperactive variants|

---

EP0918872B1|1996-08-02|2008-02-20|Bristol-Myers Squibb Company|A method for inhibiting immunoglobulin-induced toxicity resulting from the use of immunoglobulins in therapy and in vivo diagnosis|

---

US7247302B1|1996-08-02|2007-07-24|Bristol-Myers Squibb Company|Method for inhibiting immunoglobulin-induced toxicity resulting from the use of immunoglobulins in therapy and in vivo diagnosis|

---

PT932417E|1996-10-17|2003-07-31|Immunomedics Inc|NAX ANTIGENIC TOXIN CONJUGATE AND SYSTEM FUSEO PROTEIN INTERIORIZATION RECEIVER|

---

US6653104B2|1996-10-17|2003-11-25|Immunomedics, Inc.|Immunotoxins, comprising an internalizing antibody, directed against malignant and normal cells|

---

US20030077594A1|1997-06-16|2003-04-24|Genentech, Inc.|Secreted and transmembrane polypeptides and nucleic acids encoding the same|

---

US6127977A|1996-11-08|2000-10-03|Cohen; Nathan|Microstrip patch antenna with fractal structure|

---

WO1998023289A1|1996-11-27|1998-06-04|The General Hospital Corporation|MODULATION OF IgG BINDING TO FcRn|

---

US6277375B1|1997-03-03|2001-08-21|Board Of Regents, The University Of Texas System|Immunoglobulin-like domains with increased half-lives|

---

US7074592B2|1997-09-17|2006-07-11|Genetech, Inc.|Secreted and transmembrane polypeptides nucleic acid encoding|

---

US6280991B1|1997-10-15|2001-08-28|Wisconsin Alumni Research Foundation|Engineered cytotoxic ribonclease|

---

US5840296A|1997-10-15|1998-11-24|Raines; Ronald T.|Engineered cytotoxic ribonuclease A|

---

CA2323757C|1998-04-02|2011-08-02|Genentech, Inc.|Antibody variants and fragments thereof|

---

US6194551B1|1998-04-02|2001-02-27|Genentech, Inc.|Polypeptide variants|

---

US6528624B1|1998-04-02|2003-03-04|Genentech, Inc.|Polypeptide variants|

---

US6242195B1|1998-04-02|2001-06-05|Genentech, Inc.|Methods for determining binding of an analyte to a receptor|

---

GB9809951D0|1998-05-08|1998-07-08|Univ Cambridge Tech|Binding molecules|

---

CA2341029A1|1998-08-17|2000-02-24|Abgenix, Inc.|Generation of modified molecules with increased serum half-lives|

---

US6660843B1|1998-10-23|2003-12-09|Amgen Inc.|Modified peptides as therapeutic agents|

---

EP1006183A1|1998-12-03|2000-06-07|Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V.|Recombinant soluble Fc receptors|

---

US6239257B1|1998-12-30|2001-05-29|Alfacell Corporation|Family of proteins belonging to the pancreatic ribonuclease a superfamily|

---

US6737056B1|1999-01-15|2004-05-18|Genentech, Inc.|Polypeptide variants with altered effector function|

---

HU0104865A3|1999-01-15|2004-07-28|Genentech Inc|Polypeptide variants with altered effector function|

---

IL147270D0|1999-07-02|2002-08-14|Genentech Inc|Fusion peptides comprising a peptide ligand domain and a multimerization domain|

---

US6175003B1|1999-09-10|2001-01-16|Alfacell Corporation|Nucleic acids encoding ribonucleases and methods of making them|

---

EP1246643A4|1999-10-14|2005-05-11|Jeffery A Ledbetter|Dna vaccines encoding antigen linked to a domain that binds cd40|

---

GB0029407D0|2000-12-01|2001-01-17|Affitech As|Product|

---

ES2727425T3|2000-12-12|2019-10-16|Medimmune Llc|Molecules with prolonged half-lives, compositions and uses thereof|

---

US7754208B2|2001-01-17|2010-07-13|Trubion Pharmaceuticals, Inc.|Binding domain-immunoglobulin fusion proteins|

---

US7754209B2|2003-07-26|2010-07-13|Trubion Pharmaceuticals|Binding constructs and methods for use thereof|

---

US20030133939A1|2001-01-17|2003-07-17|Genecraft, Inc.|Binding domain-immunoglobulin fusion proteins|

---

US7829084B2|2001-01-17|2010-11-09|Trubion Pharmaceuticals, Inc.|Binding constructs and methods for use thereof|

---

US7319139B2|2001-01-29|2008-01-15|Biogen Idec, Inc.|TAG-72 specific CH2 domain deleted antibodies|

---

JP2005503109A|2001-01-29|2005-02-03|アイデックファーマスーティカルズコーポレイション|Modified antibodies and methods of use|

---

HU0303428A2|2001-03-07|2004-01-28|Merck Patent Gmbh.|Expression technology for proteins containing a hybrid isotype antibody moiety|

---

JP4586310B2|2001-07-04|2010-11-24|株式会社Ｉｈｉ|Manufacturing method of ceramic composite member|

---

US20040002587A1|2002-02-20|2004-01-01|Watkins Jeffry D.|Fc region variants|

---

US20090010920A1|2003-03-03|2009-01-08|Xencor, Inc.|Fc Variants Having Decreased Affinity for FcyRIIb|

---

US8093357B2|2002-03-01|2012-01-10|Xencor, Inc.|Optimized Fc variants and methods for their generation|

---

US20060235208A1|2002-09-27|2006-10-19|Xencor, Inc.|Fc variants with optimized properties|

---

US7317091B2|2002-03-01|2008-01-08|Xencor, Inc.|Optimized Fc variants|

---

US8388955B2|2003-03-03|2013-03-05|Xencor, Inc.|Fc variants|

---

WO2003074569A2|2002-03-01|2003-09-12|Immunomedics, Inc.|Bispecific antibody point mutations for enhancing rate of clearance|

---

US7666417B2|2003-04-22|2010-02-23|Fred Hutchinson Cancer Research Center|Methods and compositions for treating autoimmune diseases or conditions|

---

EP1539940A4|2002-06-14|2006-02-22|Wisconsin Alumni Res Found|Ribonuclease zymogen design|

---

DK1534335T4|2002-08-14|2015-10-05|Macrogenics Inc|FCGAMMARIIB-SPECIFIC ANTIBODIES AND PROCEDURES FOR USE THEREOF|

---

WO2006085967A2|2004-07-09|2006-08-17|Xencor, Inc.|OPTIMIZED ANTI-CD20 MONOCONAL ANTIBODIES HAVING Fc VARIANTS|

---

US20040132101A1|2002-09-27|2004-07-08|Xencor|Optimized Fc variants and methods for their generation|

---

AT541857T|2002-09-27|2012-02-15|Xencor Inc|OPTIMIZED FC VARIANTS AND MANUFACTURING METHOD THEREFOR|

---

CA2502904C|2002-10-15|2013-05-28|Protein Design Labs, Inc.|Alteration of fcrn binding affinities or serum half-lives of antibodies by mutagenesis|

---

WO2005123780A2|2004-04-09|2005-12-29|Protein Design Labs, Inc.|Alteration of fcrn binding affinities or serum half-lives of antibodies by mutagenesis|

---

JP2006515747A|2002-11-01|2006-06-08|ジェネンテック・インコーポレーテッド|Compositions and methods for the treatment of immune related diseases|

---

GB2395337B|2002-11-14|2005-12-28|Gary Michael Wilson|Warning Unit|

---

US20060040262A1|2002-12-27|2006-02-23|Morris David W|Novel compositions and methods in cancer|

---

JP2006524039A|2003-01-09|2006-10-26|マクロジェニクス，インコーポレーテッド|Identification and production of antibody containing mutant Fc region and use thereof|

---

US7067298B2|2003-03-31|2006-06-27|Ambion, Inc.|Compositions and methods of using a synthetic Dnase I|

---

AU2004266159A1|2003-08-22|2005-03-03|Biogen Idec Ma Inc.|Improved antibodies having altered effector function and methods for making the same|

---

GB0324368D0|2003-10-17|2003-11-19|Univ Cambridge Tech|Polypeptides including modified constant regions|

---

WO2005063815A2|2003-11-12|2005-07-14|Biogen Idec Ma Inc.|Fcϝ receptor-binding polypeptide variants and methods related thereto|

---

WO2005047327A2|2003-11-12|2005-05-26|Biogen Idec Ma Inc.|NEONATAL Fc RECEPTOR -BINDING POLYPEPTIDE VARIANTS, DIMERIC Fc BINDING PROTEINS AND METHODS RELATED THERETO|

---

EP1697520A2|2003-12-22|2006-09-06|Xencor, Inc.|Fc polypeptides with novel fc ligand binding sites|

---

JP2008504008A|2003-12-31|2008-02-14|メルク　パテント　ゲゼルシャフト　ミット　ベシュレンクテル　ハフトング|Fc-erythropoietin fusion protein with improved pharmacokinetics|

---

EA009746B1|2004-01-12|2008-04-28|Эпплайд Молекьюлар Эволюшн, Инк.|Fc region variants|

---

JP5150103B2|2004-02-13|2013-02-20|イミューノメディクス、インコーポレイテッド|Fusion protein containing recombinant cytotoxic RNAse|

---

CA2561264A1|2004-03-24|2005-10-06|Xencor, Inc.|Immunoglobulin variants outside the fc region|

---

US8470315B2|2004-04-13|2013-06-25|Quintessence Biosciences, Inc.|Non-natural ribonuclease conjugates as cytotoxic agents|

---

KR100863776B1|2004-07-15|2008-10-16|젠코어 인코포레이티드|OPTIMIZED Fc VARIANTS|

---

EP1791866A2|2004-08-11|2007-06-06|Trubion Pharmaceuticals, Inc.|Binding domain fusion proteins|

---

WO2006047350A2|2004-10-21|2006-05-04|Xencor, Inc.|IgG IMMUNOGLOBULIN VARIANTS WITH OPTIMIZED EFFECTOR FUNCTION|

---

DE102005009219A1|2005-02-25|2006-08-31|Martin-Luther-Universität Halle-Wittenberg|New ribonuclease tandem enzyme, useful for treating tumors, comprising 2 ribonuclease units connected covalently through a peptide linker|

---

US20110123440A1|2005-03-29|2011-05-26|Genevieve Hansen|Altered Antibody FC Regions and Uses Thereof|

---

CA2605781A1|2005-05-09|2007-04-12|Glycart Biotechnology Ag|Antigen binding molecules having modified fc regions and altered binding to fc receptors|

---

JP2008546391A|2005-06-16|2008-12-25|ウイスコンシンアラムニリサーチファンデーション|Cytotoxic ribonuclease mutant|

---

JP5114392B2|2005-06-16|2013-01-09|ウイスコンシンアラムニリサーチファンデーション|Cytotoxic ribonuclease mutant|

---

CA2616395C|2005-07-25|2016-10-04|Trubion Pharmaceuticals|B-cell reduction using cd37-specific and cd20-specific binding molecules|

---

US20080279850A1|2005-07-25|2008-11-13|Trubion Pharmaceuticals, Inc.|B-Cell Reduction Using CD37-Specific and CD20-Specific Binding Molecules|

---

AR056138A1|2005-10-21|2007-09-19|Hoffmann La Roche|PROCEDURE FOR THE RECOMBINANT EXPRESSION OF A POLYPEPTIDE|

---

WO2007121354A2|2006-04-14|2007-10-25|Trubion Pharmaceuticals Inc.|Binding proteins comprising immunoglobulin hinge and fc regions having altered fc effector functions|

---

WO2007122511A2|2006-04-21|2007-11-01|Mab-Factory Gmbh|Antibody-rnase-conjugate|

---

GB0611444D0|2006-06-09|2006-07-19|Medical Res Council Technology|Rnase H2 complex and genes therefor|

---

MX363905B|2006-06-12|2019-04-08|Aptevo Res & Development Llc|Single-chain multivalent binding proteins with effector function.|

---

EP1905841A1|2006-09-25|2008-04-02|Max Delbrück Centrum für Molekulare Medizin Berlin-Buch;|Trex1 as a marker for lupus erythematosus|

---

CA2682605A1|2007-04-18|2008-10-30|Zymogenetics, Inc.|Single chain fc, methods of making and methods of treatment|

---

WO2008150485A2|2007-05-29|2008-12-11|Wyeth|Erbb2 binding proteins and use thereof|

---

WO2008156713A2|2007-06-12|2008-12-24|Wyeth|Anti-cd20 therapeutic compositions and methods|

---

CA2691819A1|2007-07-06|2009-02-19|Trubion Pharmaceuticals, Inc.|Binding peptides having a c-terminally disposed specific binding domain|

---

WO2009015345A1|2007-07-25|2009-01-29|Amgen Inc.|Pharmaceutical compositions comprising fc fusion proteins|

---

CA2720628A1|2007-07-26|2009-01-29|Novagen Holding Corporation|Fusion proteins having mutated immunoglobulin hinge region|

---

CA2705542A1|2007-11-13|2009-05-22|Sapphire Energy, Inc.|Production of fc-fusion polypeptides in eukaryotic algae|

---

ES2368700T3|2008-04-11|2011-11-21|Emergent Product Development Seattle, Llc|IMMUNOTHERAPEUTIC AGENT FOR CD37 AND COMBINATION WITH A BIFUNCTIONAL CHEMOTHERAPEUTIC AGENT OF THE SAME.|

---

CA2736373A1|2008-09-26|2010-04-01|Timothy W. Behrens|Methods for treating, diagnosing, and monitoring lupus|

---

EP2334695B1|2008-10-01|2015-12-23|Quintessence Biosciences, Inc.|Therapeutic ribonucleases|

---

CA3091939A1|2009-11-02|2011-05-05|University Of Washington|Therapeutic nuclease compositions and methods|

---

TWI529163B|2011-01-25|2016-04-11|陶氏農業科學公司|Process for the preparation of 4-amino-5-fluoro-3-halo-6-picolinates|

---

BR112013021351A2|2011-02-23|2016-09-20|Amgen Inc|cell culture medium for exposure to ultraviolet light and related methods|

---

CN107090470B|2011-02-25|2021-09-07|重组股份有限公司|Genetically modified animals and methods of making the same|

---

JP6042871B2|2011-04-21|2016-12-14|アイオーニス ファーマシューティカルズ， インコーポレーテッドＩｏｎｉｓ Ｐｈａｒｍａｃｅｕｔｉｃａｌｓ，Ｉｎｃ．|Regulation of hepatitis B virus expression|

---

SG10201913930UA|2011-04-29|2020-03-30|Univ Washington|Therapeutic nuclease compositions and methods|

---

US20140178479A1|2011-08-12|2014-06-26|Perosphere, Inc.|Concentrated Felbamate Formulations for Parenteral Administration|

---

JP5782185B2|2012-06-01|2015-09-24|日本電信電話株式会社|Packet transfer processing method and packet transfer processing device|

---

US9300829B2|2014-04-04|2016-03-29|Canon Kabushiki Kaisha|Image reading apparatus and correction method thereof|CA3091939A1|2009-11-02|2011-05-05|University Of Washington|Therapeutic nuclease compositions and methods|

---

SG10201913930UA|2011-04-29|2020-03-30|Univ Washington|Therapeutic nuclease compositions and methods|

---

US9603907B2|2012-02-01|2017-03-28|Protalix Ltd.|Dry powder formulations of dNase I|

---

EP2946015B1|2013-01-16|2021-05-26|Emory University|Cas9-nucleic acid complexes and uses related thereto|

---

SI3063275T1|2013-10-31|2020-02-28|Resolve Therapeutics, Llc|Therapeutic nuclease-albumin fusions and methods|

---

US9599606B2|2014-06-10|2017-03-21|The Board Of Regents Of The University Of Texas System|ADP-ribose detection reagents|

---

WO2016069889A1|2014-10-31|2016-05-06|Resolve Therapeutics, Llc|Therapeutic nuclease-transferrin fusions and methods|

---

US10117911B2|2015-05-29|2018-11-06|Agenovir Corporation|Compositions and methods to treat herpes simplex virus infections|

---

DK3328881T3|2015-09-08|2019-10-07|Theripion Inc|APOA-1 FUSION POLYPEPTIDES AND RELATED COMPOSITIONS AND PROCEDURES|

---

PE20190562A1|2016-05-27|2019-04-22|Abbvie Biotherapeutics Inc|BISPECIFIC UNION PROTEINS THAT JOIN AN IMMUNOMODULATORY PROTEIN AND A TUMOR ANTIGEN|

---

MA45554A|2016-07-01|2019-05-08|Resolve Therapeutics Llc|OPTIMIZED BINUCLEASE FUSIONS.|

---

WO2018136163A2|2016-12-09|2018-07-26|Theripion, Inc.|Tandem apoa-1 fusion polypeptides|

---

CN113597319A|2019-01-04|2021-11-02|分解治疗有限责任公司|Treatment of xerosis with nuclease fusion proteins|

---

JP2020136505A|2019-02-20|2020-08-31|株式会社Ｊｏｌｅｄ|Semiconductor device and display device|

---

WO2021142456A1|2020-01-11|2021-07-15|Yale University|Compositions and methods for treating, ameliorating, and/or preventing diseases or disorders caused by or associated with dnase1 and/or dnase1l3 deficiency|

---

CN112088903A|2020-09-28|2020-12-18|武汉愔紫生物科技有限公司|Application of macromolecular protein in antibacterial and antiviral disinfectant|

法律状态:
2018-01-23| B07D| Technical examination (opinion) related to article 229 of industrial property law [chapter 7.4 patent gazette]|

---

2018-04-03| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2019-07-02| B07E| Notification of approval relating to section 229 industrial property law [chapter 7.5 patent gazette]|Free format text: NOTIFICACAO DE ANUENCIA RELACIONADA COM O ART 229 DA LPI |

---

2019-09-10| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2020-05-05| B06A| Patent application procedure suspended [chapter 6.1 patent gazette]|

---

2020-11-10| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2021-01-19| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 27/04/2012, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

US201161480961P| true| 2011-04-29|2011-04-29|

---

US61/480,961|2011-04-29|

---

US201261617241P| true| 2012-03-29|2012-03-29|

---

US61/617,241|2012-03-29|

---

PCT/US2012/035614|WO2012149440A2|2011-04-29|2012-04-27|Therapeutic nuclease compositions and methods|

---